BBa_M36245 1 BBa_M36245 PCad Promoter 2011-12-09T12:00:00Z 2015-05-08T01:14:04Z Comes from E.Coli genome. This promoter, taken from E.Coli is designed with the CadC protein as a transcription factor. In nature, it lies upstream of the CadA and CadB genes which code for cadmium resistance. false false _848_ 0 11062 9 Not in stock false Ensuring to encode entire CadC binding site through +1 site for transcription. false Bianca Kapoor, Sally Winkler BBa_M36245_sequence 1 tttgtgttatttcacctaatctttaggattaatccttttttcgtgagtaatcttatcgccagtttggtctggtcaggaaatagttatacatcatgacccggactccaaattcaaaaatgaaattaggagaagagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z