BBa_M36263 1 BBa_M36263 LasI optimized for E. coli 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z Sequence originally obtained from: http://www.pseudomonas.com/getAnnotation.do?locusID=PA1432 The sequence was optimized for E. coli by DNA 2.0. Quorum sensing is a system bacteria use to coordinate behaviors that correlate to cell density. Each species of bacteria produces and senses a unique, diffusable small molecule. This allows bacteria to "count" how many cells of their species are in the vicinity. Pseudomonas Aeruginosa, an opportunistic human pathogen associated with cystic fibrosis, uses two quorum sensing systems, with one of them being LasI/LasR. LasI produces N-(3-oxododecanoyl)-homoserine lactone, and LasR detects it. This part begins with a start codon and ends with the stop codon for the LasI gene. false false _848_ 0 24142 9 Not in stock false N/A false Diana Gong annotation2429160 1 LasI range2429160 1 1 606 annotation2429156 1 Stop Codon range2429156 1 604 606 annotation2429155 1 Start Codon range2429155 1 1 3 BBa_M36263_sequence 1 atgattgtgcagattggtcgtcgtgaagaatttgataagaaactgctgggtgagatgcataagctgcgcgcacaagtgttcaaagagcgtaagggttgggacgtcagcgtgatcgacgaaatggaaatcgatggctatgatgcactgtccccttattacatgctgatccaagaggacacgccagaggcgcaagtttttggctgctggcgcattctggacacgactggtccgtacatgttgaaaaacacctttccggaattgctgcacggcaaagaggcgccgtgttctccgcacatctgggaactgagccgtttcgccatcaatagcggtcagaaaggttcgctgggcttcagcgactgcaccctggaagccatgcgtgctctggcgcgttatagcctgcagaatgatattcaaacgctggttaccgtcaccaccgtcggtgttgagaagatgatgatccgtgcgggtcttgatgttagccgcttcggtccgcatctgaagattggcatcgagcgcgctgttgcactgcgtattgagttgaacgcgaaaacccagattgcgctctacggtggcgtcctggtggagcagcgcctggccgtgagctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z