BBa_M36264 1 BBa_M36264 LasR optimized for E. coli 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z The original LasR sequence was obtained from: http://www.uniprot.org/uniprot/P25084 This sequence was optimized for E. coli and our composite part by DNA 2.0. Quorum sensing is a system bacteria use to coordinate behaviors that correlate to cell density. Each species of bacteria produces and senses a unique, diffusable small molecule. This allows bacteria to "count" how many cells of their species are in the vicinity. Pseudomonas Aeruginosa, an opportunistic human pathogen associated with cystic fibrosis, uses two quorum sensing systems, with one of them being LasI/LasR. LasR binds to N-(3-oxododecanoyl)-homoserine lactone, which is produced by LasI, to form a complex that regulates quorum sensing-related genes. This part begins with a start codon and ends with the stop codon for the LasR gene. false false _848_ 0 24142 9 Not in stock false N/A false Diana Gong annotation2429158 1 Stop Codon range2429158 1 718 720 annotation2429157 1 Start Codon range2429157 1 1 3 annotation2429159 1 LasR range2429159 1 1 720 BBa_M36264_sequence 1 atggccctggttgacggctttttggaattggaacgtagctctggtaaactggagtggtcagcaatcctgcagaaaatggctagcgacctgggcttcagcaagattctgtttggtctgttgccgaaggattcccaggactacgagaacgcctttatcgtcggtaattaccctgctgcgtggcgcgagcactacgatcgtgcgggctatgcgcgtgttgacccgaccgtcagccactgcactcaaagcgttctgccgattttctgggagccgagcatctatcagacgcgcaagcaacatgaattcttcgaagaggcaagcgccgcgggcctggtgtatggtctgacgatgccgctgcatggcgcacgcggcgagctgggtgcgctgagcctgagcgtcgaagcggaaaatcgtgcagaggcgaaccgctttatcgagagcgtactgccaaccctctggatgctgaaagattacgcgctgcagtcgggtgccggtctggctttcgagcacccggtgagcaaaccggttgttttgacgtcttgggagaaagaagtcctgcaatggtgtgcgatcggtaaaaccagctgggagatcagcgtgatttgtaactgctccgaagcgaacgtgaatttccacatgggtaacattcgtcgtaagtttggcgtgaccagccgtcgtgttgccgcaattatggcagtgaatctgggtctgattaccctgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z