BBa_M36265 1 BBa_M36265 qsc102 promoter 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z The promoter sequence was obtained from Figure 3 of this paper: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC95443/pdf/jb005529.pdf Quorum sensing is a system bacteria use to coordinate behaviors that correlate to cell density. Each species of bacteria produces and senses a unique, diffusable small molecule. This allows bacteria to "count" how many cells of their species are in the vicinity. Pseudomonas Aeruginosa, an opportunistic human pathogen associated with cystic fibrosis, uses two quorum sensing systems, with one of them being LasI/LasR. When LasR interacts with N-(3-oxododecanoyl)-homoserine lactone which is produced by LasI, the complex binds to the promoter of the qsc102 gene and increases expression. false false _848_ 0 24142 9 Not in stock false N/A false Diana Gong annotation2429161 1 qsc102 promoter range2429161 1 1 67 BBa_M36265_sequence 1 acctgcccggaagggcaggttgtccctgccgggctgtgacaatttaattcgaccaggcatttcattg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z