BBa_M36266 1 BBa_M36266 biofab promoter apFAB39 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z The promoter comes from the Modular Promoter Library from the paper: "Precise and Reliable Gene Expression via Standard Transcription and Translation Initiation" by Vivek Mutalik et al. The name of the promoter in the paper is apFAB39. This is a medium strength promoter for E. coli. In the modular promoter library from which we obtained this promoter, the fluorescent actuator response in arbitrary units ranged from 0.378777 to 897.636, and promoter apFAB39 was 594.378. false false _848_ 0 24142 9 Not in stock false N/A false Diana Gong annotation2429162 1 promoter apFAB39 range2429162 1 1 47 BBa_M36266_sequence 1 aaaaagagtattgacttcaggaaaatttttctgatacttacagccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z