BBa_M36282 1 BBa_M36282 5' Bicistronic UTR, includes ATG start codon 2011-11-29T12:00:00Z 2015-05-08T01:14:04Z BioFab: apFAB563 This sequence contains an RBS followed by the sequence TAATG. The parts number is BBa_M36000 (PartsRegistry). The first RBS sequence is strong, while the second one is weak. This stops the first polymerase with the stop codon TAA, but allows for a second polymerase to bind to the start codon ATG(BIOFAB). This sequence prevents a hairpin loop from being formed with another part of the sequence, which would decrease the amount of translation. The bicistronic sequence ends with a start codon ATG. false true _848_ 0 11068 9 Not in stock false no false Sunil Bodapati, Julia Joung, Daniel Esquivel-Reynoso annotation2166677 1 Start Codon range2166677 1 86 88 BBa_M36282_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z