BBa_M36283 1 BBa_M36283 Human Alcohol Dehydrogenase 1B actuator 2011-11-29T12:00:00Z 2015-05-08T01:14:04Z Bicistonic RBS - BioFab: apFAB563 ADH1B - partsregistry: BBa_M36666 Histidine Tag - 6 histidines Stop Codon - generic TAG Terminator - BIOFAB: apFAB391 Our proposed gene sequence is an actuator that produces ADH1B following an RNA polymerase per second (PoPS) signal from a sensor. The sensor will be followed by a bi-cistronic ribosome binding sequence provided by BIOFAB (BD2). This type of ribosome binding sequence contains a ribosome binding site followed by the DNA sequence TAATG, which terminates translation of the first part with stop codon TAA. A second ribosome can bind in the sequence and start translation of the gene with start codon ATG. The bi-cistronic ribosome binding sequence prevents the protein???s ribosome binding site from forming a hairpin loop with another part of the sequence, which would reduce the amount of translation. Specifically, our group chose to use BD2 because it offers consistently high to medium expression of the gene of interest. After BD2, we have inserted the gene sequence of ADH1B, which we constructed using the protein sequence from protein database UniProt that was cross referenced with NCBI. Since we are inserting a eukaryotic gene into a prokaryote, we optimized the DNA sequence for E. Coli using a codon optimizing chart provided by Sharp et al. (1988), selecting for highly transcribed genes as our objective is to produce large amounts of the enzyme. Our ADH1B gene was followed by a histidine tag consisting of 6 histidines that can be used to purify the enzyme with nickel affinity chromatography. Then we put a stop codon TAG that terminates translation. Lastly, we placed a transcription terminator, part apFAB391 provided by Biofab, that terminates transcription 99% of the time because our objective is to transcribe ADH1B so we would want to prevent transcribing other proteins on the same plasmid to conserve energy. true false _848_ 0 11068 9 Discontinued false We maximized expression by using a highly expressing bicistronic RBS. We needed a way to purify the enzyme post production. The histidine tag allows us to perform nickel affinity chromatography to isolate purified protein. false Sunil Bodapati, Julia Joung, Daniel Esquivel-Reynoso component2166158 1 BBa_M36280 component2166160 1 BBa_M36282 component2166159 1 BBa_M36281 annotation2166158 1 BBa_M36280 range2166158 1 1 1143 annotation2166160 1 BBa_M36282 range2166160 1 1242 1329 annotation2166159 1 BBa_M36281 range2166159 1 1152 1233 BBa_M36281 1 BBa_M36281 High Efficiency Terminator 2011-11-29T12:00:00Z 2015-05-08T01:14:04Z BIOFAB: apFAB391 This terminator works with 99% efficiency. false false _848_ 0 11068 9 Not in stock false High efficiency terminator false Sunil Bodapati, Julia Joung, Daniel Esquivel-Reynoso BBa_M36282 1 BBa_M36282 5' Bicistronic UTR, includes ATG start codon 2011-11-29T12:00:00Z 2015-05-08T01:14:04Z BioFab: apFAB563 This sequence contains an RBS followed by the sequence TAATG. The parts number is BBa_M36000 (PartsRegistry). The first RBS sequence is strong, while the second one is weak. This stops the first polymerase with the stop codon TAA, but allows for a second polymerase to bind to the start codon ATG(BIOFAB). This sequence prevents a hairpin loop from being formed with another part of the sequence, which would decrease the amount of translation. The bicistronic sequence ends with a start codon ATG. false true _848_ 0 11068 9 Not in stock false no false Sunil Bodapati, Julia Joung, Daniel Esquivel-Reynoso annotation2166677 1 Start Codon range2166677 1 86 88 BBa_M36280 1 BBa_M36280 Human Alcohol Dehydrogenase 1B 2011-11-29T12:00:00Z 2015-05-08T01:14:04Z P00325 (ADH1B_HUMAN) provided by UniProt. This gene sequence encodes for the human protein alcohol dehydrogenase which converts ethanol into acetaldehyde in the presence of zinc as its cofactor. false false _848_ 0 11068 9 Not in stock false This sequence has been codon optimized for high expression in E. Coli. false Sunil Bodapati, Julia Joung, Daniel Esquivel-Reynoso annotation2166154 1 Histidine range2166154 1 1123 1140 annotation2166155 1 stop codon range2166155 1 1141 1143 annotation2166488 1 alcohol dehydrogenase 1b range2166488 1 1 1122 BBa_M36280_sequence 1 tctactgctggtaaagttatcaaatgcaaagctgctgttctgtgggaagttaaaaaaccgttctctatcgaagacgttgaagttgctccgccgaaagcttacgaagttcgtatcaaaatggttgctgttggtatctgccgtactgacgaccacgttgtttctggtaacctggttactccgctgccggttatcctgggtcacgaagctgctggtatcgttgaatctgttggtgaaggtgttactactgttaaaccgggtgacaaagttatcccgctgttcactccgcagtgcggtaaatgccgtgtttgcaaaaacccggaatctaactactgcctgaaaaacgacctgggtaacccgcgtggtactctgcaggacggtactcgtcgtttcacttgccgtggtaaaccgatccaccacttcctgggtacttctactttctctcagtacactgttgttgacgaaaacgctgttgctaaaatcgacgctgcttctccgctggaaaaagtgtgcctgatcggttgcggtttctctactggttacggttccgctgttaacgttgctaaagttactccgggttctacttgcgctgttttcggtctgggtggtgttggtctgtctgctgttatgggttgcaaagcagctggcgctgctcgtatcatcgctgtggacatcaacaaagacaaattcgctaaagctaaagaactgggtgctactgaatgcatcaacccgcaggactacaaaaaaccgatccaggaagttctgaaagaaatgactgacggtggcgttgacttctcgttcgaagttatcggtcgtctggacactatgatggcttctctgctgtgctgccacgaagcatgcggcacctccgtaatcgttggtgttccgccggcttcccagaacctgtccatcaacccgatgctgctgctgaccggccgtacttggaaaggtgctgtttacggcggcttcaaatctaaagaaggtatcccgaaactggtagctgacttcatggcaaaaaaattctccctggacgctctgatcacccacgttctgccgttcgaaaaaatcaacgaaggtttcgacctgctgcactccggcaaatctatccgtactgttctgaccttccaccaccatcaccaccattag BBa_M36282_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg BBa_M36281_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36283_sequence 1 tctactgctggtaaagttatcaaatgcaaagctgctgttctgtgggaagttaaaaaaccgttctctatcgaagacgttgaagttgctccgccgaaagcttacgaagttcgtatcaaaatggttgctgttggtatctgccgtactgacgaccacgttgtttctggtaacctggttactccgctgccggttatcctgggtcacgaagctgctggtatcgttgaatctgttggtgaaggtgttactactgttaaaccgggtgacaaagttatcccgctgttcactccgcagtgcggtaaatgccgtgtttgcaaaaacccggaatctaactactgcctgaaaaacgacctgggtaacccgcgtggtactctgcaggacggtactcgtcgtttcacttgccgtggtaaaccgatccaccacttcctgggtacttctactttctctcagtacactgttgttgacgaaaacgctgttgctaaaatcgacgctgcttctccgctggaaaaagtgtgcctgatcggttgcggtttctctactggttacggttccgctgttaacgttgctaaagttactccgggttctacttgcgctgttttcggtctgggtggtgttggtctgtctgctgttatgggttgcaaagcagctggcgctgctcgtatcatcgctgtggacatcaacaaagacaaattcgctaaagctaaagaactgggtgctactgaatgcatcaacccgcaggactacaaaaaaccgatccaggaagttctgaaagaaatgactgacggtggcgttgacttctcgttcgaagttatcggtcgtctggacactatgatggcttctctgctgtgctgccacgaagcatgcggcacctccgtaatcgttggtgttccgccggcttcccagaacctgtccatcaacccgatgctgctgctgaccggccgtacttggaaaggtgctgtttacggcggcttcaaatctaaagaaggtatcccgaaactggtagctgacttcatggcaaaaaaattctccctggacgctctgatcacccacgttctgccgttcgaaaaaatcaacgaaggtttcgacctgctgcactccggcaaatctatccgtactgttctgaccttccaccaccatcaccaccattagtactagagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtctactagaggggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z