BBa_M36288 1 BBa_M36288 medium 5' Bicistronic UTR (BD21) 2011-12-09T12:00:00Z 2015-05-08T01:14:04Z BIOFAB.org apFAB599 This part is a 5' UTR of medium strength (varying with it upstream promoter) based on bicistronic junction architecture. The first RBS is strong and drives expression of short leader cistron. The second RBS is internal to the first cistron and controls translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false true _848_ 0 11080 9 Not in stock false - false Victoria Robles, Kyung Ri Park, Ken Xiong annotation2166696 1 dna range2166696 1 1 88 BBa_M36288_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgagggatggtttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z