BBa_M36292 1 BBa_M36292 Transcription Terminator (99% efficient) 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z The part comes from the E. Coli chassis. This is a terminator sequence to stop transcription. Put it at the very end of your sequence. false false _848_ 0 11078 9 Not in stock false The sequence is originally from BIOFAB. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36292_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z