BBa_M36293 1 BCRBS 5' Bicistronic UTR, includes ATG start 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z This part is from the E. Coli chassis. This is a bicistonic sequence which includes a ribosome binding site, a leader, another ribosome binding site, and the start codon ATG. This goes at the beginning of the actuator to help the ribosome bind and start translation. false false _848_ 0 11078 9 Not in stock false This sequence is originally from BIOFAB. It is part BD12, apFAB535. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36293_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctgcggagggtttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z