BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_M36292 1 BBa_M36292 Transcription Terminator (99% efficient) 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z The part comes from the E. Coli chassis. This is a terminator sequence to stop transcription. Put it at the very end of your sequence. false false _848_ 0 11078 9 Not in stock false The sequence is originally from BIOFAB. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_K133132 1 linker 8 aa protein domain linker 2008-10-23T11:00:00Z 2015-05-08T01:09:57Z false false _231_ 0 3358 9 It's complicated false false Jan Lonzaric BBa_M36293 1 BCRBS 5' Bicistronic UTR, includes ATG start 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z This part is from the E. Coli chassis. This is a bicistonic sequence which includes a ribosome binding site, a leader, another ribosome binding site, and the start codon ATG. This goes at the beginning of the actuator to help the ribosome bind and start translation. false false _848_ 0 11078 9 Not in stock false This sequence is originally from BIOFAB. It is part BD12, apFAB535. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36296 1 halt Stop Codon TAA 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z None This is a stop codon for E.coli. The sequence is TAA true false _848_ 0 11065 9 Discontinued false Codon optimized for E.coli false Christopher Jackson BBa_M36502 1 Jun Jun-p1n 2011-12-03T12:00:00Z 2015-05-08T01:14:05Z O'Shea, E., R. Rutkowski, W. Stafford, and P. Kim. "Preferential Heterodimer Formation by Isolated Leucine Zippers from Fos and Jun." Science 245.4918 (1989): 646-48. Print. Jun-p1n is a protein domain that contains a leucine zipper that covalently bonds to Fos-p1n. Jun-p1n is useful for creating heterodimerized proteins that self-assemble into tightly linked chains. false false _848_ 0 11084 9 Not in stock false This part was codon optimized for expression in the E. coli bacterium. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36295 1 BBa_M36295 Spider Silk GFP Actuator 2011-12-06T12:00:00Z 2015-05-08T01:14:04Z RBS Leader and ATG came from BioFAB. Terminator comes from BioFAB. FOS-JUN leucine zipper sequences were taken from O'Shea et al. They were also codon optimized for E.coli. This is the full sequence for the spider silk GFP actuator. It was the positive control to test if the FOS and JUN sequences worked. It includes the bicistonic sequence, FOS, a linker, GFP, another linker, JUN, a stop codon, and a transcription terminator. It is triggered by PoPS. false false _848_ 0 11078 9 Not in stock true The overall design had a 3000 base pair limit. FOS and JUN leucine zippers were used to covalently bond GFP proteins to create a larger strand. false Dominique Dabija, Christopher Jackson, Debha Amatya component2166491 1 BBa_K133132 component2166493 1 BBa_E0040 component2166489 1 BBa_M36293 component2166497 1 BBa_M36292 component2166490 1 BBa_M36501 component2166494 1 BBa_K133132 component2166495 1 BBa_M36502 component2166496 1 BBa_M36296 annotation2166493 1 BBa_E0040 range2166493 1 255 974 annotation2166490 1 BBa_M36501 range2166490 1 97 216 annotation2166494 1 BBa_K133132 range2166494 1 983 1006 annotation2166495 1 BBa_M36502 range2166495 1 1015 1134 annotation2166497 1 BBa_M36292 range2166497 1 1154 1235 annotation2166491 1 BBa_K133132 range2166491 1 225 248 annotation2166489 1 BBa_M36293 range2166489 1 1 88 annotation2166496 1 BBa_M36296 range2166496 1 1143 1145 BBa_M36501 1 Fos Fos-p1n 2011-12-03T12:00:00Z 2015-05-08T01:14:05Z O'Shea, E., R. Rutkowski, W. Stafford, and P. Kim. "Preferential Heterodimer Formation by Isolated Leucine Zippers from Fos and Jun." Science 245.4918 (1989): 646-48. Print. Fos-p1n is a protein domain that contains a leucine zipper that covalently links to Jun-p1n. Fos-p1n is useful in creating heterodimerized parts that self-assemble into tightly linked chains. false false _848_ 0 11084 9 Not in stock false Design was modified to codon optimized for expression in E. coli bacterium. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36501_sequence 1 ctgaccgataccctgcaggcagaaaccgatcagctggaagataaaaaaagcgcactgcagaccgaaattgcaaatctgctgaaagaaaaagaaaaactggaatttattctggcagcatat BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K133132_sequence 1 tccgcttgttactgtgagctttcc BBa_M36293_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctgcggagggtttctaatg BBa_M36292_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36295_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctgcggagggtttctaatgtactagagctgaccgataccctgcaggcagaaaccgatcagctggaagataaaaaaagcgcactgcagaccgaaattgcaaatctgctgaaagaaaaagaaaaactggaatttattctggcagcatattactagagtccgcttgttactgtgagctttcctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagtccgcttgttactgtgagctttcctactagagcgtattgcacgtctggaagaaaaagttaaaaccctgaaagcacagaatagcgaactggcaagcaccgcaaatatgctgcgtgaacaggttgcacagctgaaacagaaagttatgaattattactagagtaatactagagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36296_sequence 1 taa BBa_M36502_sequence 1 cgtattgcacgtctggaagaaaaagttaaaaccctgaaagcacagaatagcgaactggcaagcaccgcaaatatgctgcgtgaacaggttgcacagctgaaacagaaagttatgaattat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z