BBa_M36305 1 BBa_M36305 Transcription terminator pT-T7 from bacteriophage 2011-12-08T12:00:00Z 2015-05-08T01:14:04Z T7 Bacteriophage Released HQ 2013 A transcription terminator derived from T7 bacteriophage. Use where transcription should be stopped for the gene of interest upstream of this terminator. false false _848_ 0 11095 9 In stock false None. false Darren Jindal, Raman Nelakanti, Dennis Te BBa_M36305_sequence 1 ctagcataaccccttggggcctctaaacgggtcttgaggggttttttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z