BBa_M36308 1 BBa_M36308 Copper Sensor 2011-12-01T12:00:00Z 2015-05-08T01:14:04Z Bacteria jflkdjdkljsjflj skdfjadlk dfgjfckcfkj true false _848_ 0 11033 9 Discontinued false codon optimize false Stephanie Hilliard component2166386 1 BBa_M36309 component2166383 1 BBa_M36309 annotation2166386 1 BBa_M36309 range2166386 1 36 70 annotation2166383 1 BBa_M36309 range2166383 1 1 35 BBa_M36309 1 BBa_M36309 Coding sequence for human alcohol dehydrogenase enzyme 2011-12-01T12:00:00Z 2015-05-08T01:14:04Z jkljk jklj true false _848_ 0 11033 9 Discontinued false jljk false Stephanie Hilliard annotation2166379 1 Start Codon range2166379 1 1 3 annotation2166380 1 Restriction Enzyme range2166380 1 10 15 BBa_M36309_sequence 1 atgatcgagctagctagctagctagctagctatga BBa_M36308_sequence 1 atgatcgagctagctagctagctagctagctatgaatgatcgagctagctagctagctagctagctatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z