BBa_M36356 1 Nsense A sensor that activates in the presence of nitrate in anaerobic conditions in E. coli. 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z The source for this part comes from the NIR promoter region in E. coli plasmid. This part will used along with a Green fluorescent actuator to test for the presence of nitrate. false false _848_ 0 24178 9 Not in stock false We had to deal with finding the appropriate binding areas for the promote without including any of the sequence that codes for proteins. false Ana Ordonez, Chris Harrell annotation2429019 1 FIS I range2429019 1 2 16 annotation2429611 1 Transcription Start Site range2429611 1 150 150 annotation2429010 1 IHF I range2429010 1 49 75 annotation2428944 1 NarL/P range2428944 1 74 88 annotation2429001 1 IHF II range2429001 1 22 48 annotation2428943 1 FNR range2428943 1 103 116 BBa_M36356_sequence 1 tgtctattttttgcacaaacatgaaatatcagacaattccgtgacttaagaaaatttatacaaatcagcaatatacccattaaggagtatataaaggtgaatttgatttacatcaataagcggggttgctgaatcgttaaggtaggcggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z