BBa_M36361 1 BBa_M36361 5' Bicistronic UTR (apFAB866, GENE10_BCD2), No ATG Start 2013-10-24T11:00:00Z 2015-05-08T01:14:04Z This part was sourced from the Supplemental Table 1 of Mutalik, et al., where it was constructed as a candidate sequence-independent BCD. 5' UTR based on bicistronic junction architecture, composed of a GENE10 SD1 context and a BCD2 SD2 region. Has low strength. false false _848_ 0 19036 9 Not in stock false This sequence was copied verbatim. false Ethan Li BBa_M36361_sequence 1 aataattttgtttaactttaagaaggaggtatatccatggctagcatgactaaacatcttaatcatgctaaggaggttttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z