BBa_M36362 1 BBa_M36362 DbjA Haloalkane Dehalogenase 2013-10-24T11:00:00Z 2015-05-08T01:14:04Z This part was sourced from the genomic sequence of the soil bacterium Bradyrhizobium japonicum USDA110, at Accession NP_767727 and Gene ID 27376198. No mutations were made. This part encodes an enzyme with dehalogenase activity for haloalkane substrates. DbjA catalyzes the cleavage of carbon-halogen bonds to form a primary alcohol and a halide. DbjA generally has higher overall activity than other haloalkane dehalogenases. Unlike most other known haloalkane dehalogenases, DbjA has very high activity on 2-bromo-1-chloropropane and chlorocyclopentane, and it has significant activity towards 1,2-dichloropropane (http://www.biochemj.org/bj/435/0345/bj4350345.htm). ATG and TAA stop codons are included, so this part can just be flanked by a 5' UTR translation initiator and a 3' transcription terminator for use. false false _848_ 0 19036 9 Not in stock false The amino acid sequence was backtranslated through Gene Designer's genetic algorithm (Maximum Generations: 100; Maximum Mutation Rate: 0.05; Minimum Best Individual Selection Rate: 0.9; Population Size: 50; Number of Progeny: 25) into a codon set optimized for Escherichia coli K12. This algorithm was given additional parameters to avoid BbsI, BsmBI, and BsaI restriction sites (at a weight of 1), hairpins (at a weight of 1), and repeats of at least 10 bp (at a weight of 1). A TAA stop codon was then added at the end of the resulting DNA sequence. false Will Connors, Ethan Li, and Shirbi Ish-Shalom BBa_M36362_sequence 1 atgtctaaaccgattgaaattgagattcggcgtgctccggtcttgggcagctcgatggcctatcgtgagactggtgcacaggatgctcccgttgtgctgttcctccacggcaatccgacctctagccatatttggcgcaacatcctgccactggttagtcccgttgctcactgcattgcgccggatctgattggtttcggccaatccggtaaaccggatattgcgtaccgctttttcgaccatgtccgttatttagacgcctttatcgaacagcgcggcgttacatcagcatatctggtggcgcaggactggggtaccgcgctggcgtttcatctggcagcgcgccgccccgactttgttcgtggactcgcctttatggaattcattcgcccgatgccgacgtggcaggacttccaccatacagaagtggccgaggaacaggatcacgcggaagctgcccgtgctgtgtttcgaaaattccgcacgccgggagagggagaagcaatgattcttgaagcaaacgccttcgtcgaaagggtgttaccgggcggcatcgtacgcaaactgggtgacgaggaaatggccccatatcgtactccgttcccgaccccggagagccgccgaccggtgttagcctttccacgtgagttgccgatagctggcgaaccggctgacgtttacgaggctcttcagtcggcgcatgcggccttggcggcgagttcttaccccaaactgttatttaccggagaaccaggcgccctggtgtcgccggaatttgcggagcgttttgcagcgtcgttaactcgttgcgcattgattcgccttggcgcgggcctgcattacctgcaagaggatcatgctgatgcgataggccgctccgtggcgggctggattgccggcattgaagccgtccgcccgcagcttgccgcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z