BBa_M36405 1 BBa_M36405 Bicistronic RBS (medium) pFAB1646 2012-12-05T12:00:00Z 2015-05-08T01:14:04Z More information can be found at BIOFAB.org. This is a bicistronic RBS, which consists of a constitutive RBS, and a leader sequence that includes the second RBS. It uses bicistronic junction architecture to tightly control translation. It contains two ribosome binding sites: one controls the gene of interest, and the another synthesizes a short leader protein. The latter bicistronic's translation prevents the former RBS from forming a secondary structure with the gene of interest. This ensures a more consistent expression level of your gene of interest. false false _848_ 0 15032 9 Not in stock false This RBS is of medium strength. false Justo A. Caballero, Shamik Mascharak and Sibel Sayiner BBa_M36405_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcaggggatattttctgatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z