BBa_M36413 1 BBa_M36413 MTF-1 regulated promoter 2014-10-22T11:00:00Z 2015-05-08T01:14:04Z We got this from the mouse genome. This promoter requires MTF-1 as the transcription factor. In conjunction with MTF-1, the promoter will being transcription. false false _848_ 0 24177 9 Not in stock false It needs to be coupled with MTF1 false Rocco Cervantes BBa_M36413_sequence 1 cgatctctgcactccgccccgatagggacgtgaggcgggctgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z