BBa_M36451 1 BBa_M36451 Holin Coding Sequence 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z This part came from Part BBa_K124017 in the BioBricks registry - a cell lysis package. This is the first sequence from the package. This is the sequence used to synthesize holin proteins which are used for cell lysis. Holins insert themselves in the plasma membrane of a cell and lyse the cell upon reaching a critical mass. false false _848_ 0 19315 9 Not in stock false Repeats and palindromes greater than length 10 had to be altered in order to synthesize the DNA. false Max Whitmeyer, Ian Lewis BBa_M36451_sequence 1 atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtaggaatcaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z