BBa_M36455 1 BBa_M36455 Rz Protein Coding Sequence 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z This part came from Part BBa_K124017 in the BioBricks registry - a cell lysis package. This is the third sequence from the package. Codes for an Rz protein which is a component of cell lysis. The Rz protein helps the holin penetrate the cell membrane thus allowing faster cell lysis false false _848_ 0 19315 9 Not in stock false Repeats and palindromes greater than length 10 had to be altered in order to synthesize the DNA. false Max Whitmeyer, Ian Lewis BBa_M36452 1 BBa_M36452 RBS - MCD 6 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z Found in data table from "Precise and Reliable Gene Expression via Standard Transcription and Translation Initiation Elements" Monocistronic Ribosome Binding Site with low to medium expression and low variance false false _848_ 0 19315 9 Not in stock false None false Max Whitmeyer, Ian Lewis BBa_M36454 1 BBa_M36454 MCD 20 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z Found in data table from "Precise and Reliable Gene Expression via Standard Transcription and Translation Initiation Elements" Monocistronic Ribosome Binding Site with low to medium expression and low variance false false _848_ 0 19315 9 Not in stock false None false Max Whitmeyer, Ian Lewis BBa_M36453 1 BBa_M36453 Endolysin Coding Sequence 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z This part came from Part BBa_K124017 in the BioBricks registry - a cell lysis package. This is the first sequence from the package. Codes for an endolysin protein which causes destabilization of cell walls which is useful for cell lysis. false false _848_ 0 19315 9 Not in stock false Repeats and palindromes greater than length 10 were altered in order to synthesize the DNA. One palindrome had its sequence changed. false Max Whitmeyer, Ian Lewis annotation2371731 1 C -> T range2371731 1 102 102 BBa_M36451 1 BBa_M36451 Holin Coding Sequence 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z This part came from Part BBa_K124017 in the BioBricks registry - a cell lysis package. This is the first sequence from the package. This is the sequence used to synthesize holin proteins which are used for cell lysis. Holins insert themselves in the plasma membrane of a cell and lyse the cell upon reaching a critical mass. false false _848_ 0 19315 9 Not in stock false Repeats and palindromes greater than length 10 had to be altered in order to synthesize the DNA. false Max Whitmeyer, Ian Lewis BBa_M36459 1 BBa_M36459 PoPS -> Cell Lysis 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z The sequences for all three proteins were found from Part BBa_K124017 in the BioBricks registry. All Ribosome Binding Sites and the Terminator found from the biofab website in the data section. This actuator, upon receiving a Polymerase per Second (PoPS) signal, creates 3 proteins that induce cell lysis in E. Coli. Each protein is paired with a Ribosome Binding Site already included in the sequence. This part has been proven to have consistent success in cell lysis of E. Coli. The three proteins transcribed from the sequence are a Holin (lysis the cell by inserting itself in the plasma membrane and causing cell lysis after reaching a critical mass), an Endolysin (destabilizes the cell wall), and an Rz Protein (helps the holin enter the plasma membrane). The sequence is void of all repeats and palindromes greater than or equal to 10 bp thus allowing it to be synthesized with relative ease. To use this product one would simply have to pair this part with a sensor that would then send a PoPS signal and cause the cell to lyse. This actuator has been proven to cause lysis even at very low levels of activation. Despite this, it has also been shown to not cause lysis unless activated. false false _848_ 0 19315 9 Not in stock true The sequence was altered in a few places in order to avoid repeats and palindromes. Also, the sequence had to be edited further when the Ribosome Binding Sites(RBS) were added to avoid repeats. It's also important to note that the part utilizes one Bicistronic Design(BCD) and two Monocistronic Designs(MCD) for the RBS's. Three BCDs would have been used but all BCDs have significant overlapping sequences and only one could be used to avoid repeats. All RBS's were chosen for low to medium expression level and low variance. false Ian Lewis, Max Whitmeyer component2371749 1 BBa_M36451 component2371754 1 BBa_M36455 component2371753 1 BBa_M36454 component2371748 1 BBa_M36450 component2371750 1 BBa_M36452 component2371755 1 BBa_M36456 component2371752 1 BBa_M36453 annotation2371753 1 BBa_M36454 range2371753 1 910 939 annotation2371749 1 BBa_M36451 range2371749 1 86 403 annotation2371748 1 BBa_M36450 range2371748 1 1 85 annotation2371755 1 BBa_M36456 range2371755 1 1402 1442 annotation2371750 1 BBa_M36452 range2371750 1 404 432 annotation2371754 1 BBa_M36455 range2371754 1 940 1401 annotation2371752 1 BBa_M36453 range2371752 1 433 909 BBa_M36456 1 BBa_M36456 BBa_B1006 U10 Terminator - 99% 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z This part was found in the data table of "Measurement and modeling of intrinsic transcription terminators" This terminator operates at 99.42% efficiency. false false _848_ 0 19315 9 Not in stock false None false Max Whitmeyer, Ian Lewis BBa_M36450 1 BBa_M36450 Bicistronic RBS - pFAB1692 2013-12-17T12:00:00Z 2015-05-08T01:14:05Z Found in data table from "Precise and Reliable Gene Expression via Standard Transcription and Translation Initiation Elements" Bicistronic RBS with Strain Performance: 74.59. Strain Performance SD: 2.95 false false _848_ 0 19315 9 Not in stock false None false Max Whitmeyer, Ian Lewis BBa_M36453_sequence 1 atggtagaaatcaacaatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgatgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatga BBa_M36456_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttttt BBa_M36450_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggactctttctg BBa_M36459_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcgatggactctttctgatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtaggaatcaataatcttaatcatgcgccggaggttttctaatatggtagaaatcaacaatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgatgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatgatcttaatcatgctgaggaaagtttctaatgatgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtctgcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaattactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctccccccgactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggaaggaacccagaagtatattaatgagcagtgcagatagaaaaaaaaaccccgcccctgacagggcggggtttttttttt BBa_M36452_sequence 1 tcttaatcatgcgccggaggttttctaat BBa_M36451_sequence 1 atgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtaggaatcaataa BBa_M36455_sequence 1 atgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtctgcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaattactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctccccccgactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggaaggaacccagaagtatattaatgagcagtgcagatag BBa_M36454_sequence 1 tcttaatcatgctgaggaaagtttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z