BBa_M36500 1 spilk 7.0. Spider Silk Hexamer 2011-12-03T12:00:00Z 2015-05-08T01:14:05Z The monomer amino acid sequence was taken from Xia, X.-X., Z.-G. Qian, C. S. Ki, Y. H. Park, D. L. Kaplan, and S. Y. Lee. "Native-sized Recombinant Spider Silk Protein Produced in Metabolically Engineered Escherichia Coli Results in a Strong Fiber." Proceedings of the National Academy of Sciences 107.32 (2010): 14059-4063. Print. This is a spider silk hexamer protein. The monomer amino acid sequence was taken from Xia et al. and codon optimized for expression in E. coli. Repeats above 10 base pairs were also minimized to allow for ease of synthesis. false false _848_ 0 11065 9 Not in stock false Needed to minimize repeats and allow for ideal mRNA forming without too many loops while still maintaining codon optimization for E. coli. false Dominique Dabija, Christopher Jackson, Debha Amatya annotation2166605 1 monomer 6 range2166605 1 526 630 annotation2166600 1 monomer 1 range2166600 1 1 105 annotation2166604 1 monomer 5 range2166604 1 421 525 annotation2166602 1 monomer 3 range2166602 1 211 315 annotation2166603 1 monomer 4 range2166603 1 316 420 annotation2166601 1 monomer 2 range2166601 1 106 210 BBa_M36500_sequence 1 tcaggacgggggggacttggagggcaaggagcggggatggcggcggcggccgcaatggggggagcgggacaggggggatacggagggttaggatcacaaggaacctctggaagaggaggattgggaggacagggggcagggatggcggcagctgctgctatgggcggtgctggccaaggtgggtacgggggtttagggtcccaagggacgtctgggagaggagggttgggtgggcaaggggctgggatggctgctgcagcggctatggggggcgctggacaagggggctatgggggacttgggtcccaaggaacgagcggtcggggcgggcttggggggcaaggggccggaatggcagcggctgccgcgatgggaggtgcgggacaaggagggtacggggggcttgggtctcaaggtactagcggccgggggggattaggtggccaaggagctggaatggccgcggctgcggccatgggcggagcaggtcaaggtggctatggcggattgggaagtcagggcacgtccggacgcggtggcctagggggacaaggtgcaggaatggcggctgctgctgccatgggaggggcgggccagggcggatacggtggccttgggtcacaaggtacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z