BBa_M36502 1 Jun Jun-p1n 2011-12-03T12:00:00Z 2015-05-08T01:14:05Z O'Shea, E., R. Rutkowski, W. Stafford, and P. Kim. "Preferential Heterodimer Formation by Isolated Leucine Zippers from Fos and Jun." Science 245.4918 (1989): 646-48. Print. Jun-p1n is a protein domain that contains a leucine zipper that covalently bonds to Fos-p1n. Jun-p1n is useful for creating heterodimerized proteins that self-assemble into tightly linked chains. false false _848_ 0 11084 9 Not in stock false This part was codon optimized for expression in the E. coli bacterium. false Dominique Dabija, Christopher Jackson, Debha Amatya BBa_M36502_sequence 1 cgtattgcacgtctggaagaaaaagttaaaaccctgaaagcacagaatagcgaactggcaagcaccgcaaatatgctgcgtgaacaggttgcacagctgaaacagaaagttatgaattat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z