BBa_M36515 1 BBa_M36515 Silaffin 1 Peptide Encoding Gene 2012-12-06T12:00:00Z 2015-05-08T01:14:05Z http://www.uniprot.org/uniprot/Q9SE35 This is the source of the amino acid sequence of silaffin 1 in marine diatoms. We reverse engineered this sequence to create our gene for E. coli This gene codes for a peptide called silaffin 1. It is composed of silaffin 1A1, silaffin 1A2, and silaffin 1B peptides. This gene is naturally found in marine diatoms, which use silaffin in order to incorporate silica into various cellular structures. The silaffin 1 peptide precipitates silica when isolated from an organism and reacted with silicic acid. false false _848_ 0 15034 9 Not in stock false The silaffin 1 peptide amino acid sequence found in marine diatoms can be found online at http://www.uniprot.org/uniprot/Q9SE35. Our project entailed expressing silaffin 1 in E. coli, thus we derived the DNA sequence from the online amino acid sequence and codon optimized the sequence for E. coli. We also optimized to eliminate repeats and hidden stop codons. false Kevin Bui, Jordan Shapiro, Kevin Madrigal BBa_M36515_sequence 1 aaacttaccgcaatcttcccactgctgtttaccgctgttggttattgcgcggcgcaaagtatcgccgacctggcggctgccaacctgtccaccgaagattcgaaatccgctcagcttatttcggcggactcttccgacgacgcttccgacagctctgtcgaatccgtcgacgccgcaagcagcgacgtatccggcagctcggtggaatccgtggacgtatcgggcagctccctggaaagcgtggacgtttctggctccagtctcgaatctgtggacgacagcagcgaggactccgaggaagaggagctgcgtatcctcagcagcaaaaaatcaggttcatactactcttacggtaccaagaagagcggctcgtattcgggctactctaccaaaaagtccgcgtcacgtcgtattttgtcaagcaagaagagcggctcttactccggttacagcaccaagaaaagcggttcccgtcgcatcctgtcttccaagaaatctgggtcctattctgggtccaagggctccaaacgacgtattctgtcatcaaaaaaatccggcagttacagcggctcaaaaggcagcaaacggcgcaacttgtccagcaagaagtctggttcttactctggttccaagggttcaaaacgtcgcattctttcctccaagaagtcaggttcgtactctggctccaaaggttccaaacgccgcaacctcagctcgaaaaaatctggctcctactctggcagcaaaggctccaagcgtcgtatcttgtctggtggcctgcgcggttccatgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z