BBa_M36527 1 BBa_M36527 Lactose inducible yeast promoter 2015-10-22T11:00:00Z 2016-02-10T02:35:24Z Was extracted from the BBa_K1164004 part on iGem's Registry of Standard Biological Parts. In the presence of LacI, this sequence represses gene expression. Expression can be induced by the addition of lactose or IPTG, which binds to LacI, removing it from the DNA. false false _848_ 4206 29107 9 false Had to ensure that it would work in yeast and where to put this with regards to the Kozak sequence and protein coding region. Ended up being placed directly before the Kozak sequence. false Valerie Wesley Scott BBa_M36527_sequence 1 cctctcctttttgaaatattatgcagaggttgcgcggcgtgcactgggcgcggggcaggtataaaggtgggtggtttggggtgtgtggaattgtgagcggataacaatttcacacaacgtagggggcgaacggcgagattaaaagtatcaacaaaaaatgatggtggttggtttgtgtggaaagaaatgcgagccatgtttccggatctatccc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z