BBa_M36540 1 BBa_M36540 Promoter 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ A weak promoter. Initiates transcription, makes RNA. 94 Mean Fluorescence per Cell false false _848_ 0 19061 9 Not in stock false We wanted a promoter that produced a low amount of GFP. false Danielle Fraga BBa_M36540_sequence 1 aaaaagagtattgacttttatcccttgcggcgaatacttacagccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z