BBa_M36541 1 BBa_M36541 apFAB49 Promoter activated by cAMP in E. Coli 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ apFAB49 is a promoter that gives weak constitutive expression of downstream genes. It initiates transcription, which makes RNA. The promoter has a 94 Mean Fluorescence per Cell. false false _848_ 0 19061 9 Not in stock false We wanted a promoter that had weak expression so as to not kill the E. Coli cells with toxicity from overexpression of cAMP receptor protein. false Danielle Fraga BBa_M36541_sequence 1 aaaaagagtattgacttttatcccttgcggcgaatacttacagccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z