BBa_M36542 1 BBa_M36542 BCD22 - RBS 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z Mutalek et. al. 2012 BioFab biofab.org/data (downloaded in csv format) BCD22 is a weak RBS for translation of RNA into the protein that will express GFP. false false _848_ 0 19061 9 Not in stock false We had to make sure we did not overexpress cAMP regulatory protein. false Danielle Fraga BBa_M36542_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcctaggaagttttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z