BBa_M36546 1 BBa_M36546 apFAB47 Promoter with DNA binding sequence from CRP 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ http://www.uniprot.org/uniprot/P0ACJ8 After CRP binds with cAmp, it binds to this specific DNA promoter between the -35 and -10 boxes. It is a strong promoter so that it makes a strong PoPS signal to initiate transcription of an actuator. false false _848_ 0 19061 9 Not in stock false Between the -35 box and the -10 box, we deleted the sequence from apFAB47 promoter and replaced it with the binding sequence that CRP will bind to. false Danielle Fraga BBa_M36546_sequence 1 aaaaagagtattgactaaatgtgatctagatcacattttaattatttcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z