BBa_M36544 1 BBa_M36544 cAMP-activated global transcriptional regulator CRP 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z http://www.uniprot.org/uniprot/P0ACJ8 cAMP regulatory protein (CRP) binds to cAMP, causes a conformational change, allowing binding to template DNA within the promoter. false false _848_ 0 19061 9 Not in stock false There was a one codon overlap between the RBS and the protein, so we removed that repeat. We had to find the specific regulatory protein that binds to cAMP. false Danielle Fraga BBa_M36545 1 BBa_M36545 apFAB390 Terminator 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ apFAB390 terminates transcription. It has a 99% Termination Efficiency. false false _848_ 0 19061 9 Not in stock false We wanted to be sure that transcription was terminated completely. false Danielle Fraga BBa_M36547 1 BBa_M36547 cAMP sensor 2013-12-06T12:00:00Z 2015-05-08T01:14:05Z The promoter, RBS, and terminator were sourced from Parts Registry. ???BIOFAB Promoter Data: apFAB49.??? BIOFAB, n.d. Web. 24 Oct. 2013. <http://io.biofab.org/services/studio/dac/>. Mutalik, et. al. ???Precise and reliable gene expression via standard transcription and translation initiation elements.??? Figure 4C. Nature America. 2012. Web. 24 Oct. 2013. <https://coursework.stanford.edu/access/content/group/F13-BIOE-44-01/Required%20readings/Mutalek%202012.pdf ???BIOFAB Terminator Data: apFAB390.??? BIOFAB, n.d. Web. 24 Oct. 2013. <http://io.biofab.org/services/studio/dac/>. "BIOFAB Promoter Data: apFAB47." BIOFAB, n.d. Web. 24 Oct. 2013. <http://io.biofab.org/services/studio/dac/>. The CRP coding sequence was sourced from UniProtKB. ???P0ACJ8 (CRP_ECOLI) Reviewed.??? Protein Knowledgebase(UniProtKB). UniProtKB/Swiss-Prot, n.d. Web. 25 Oct. 2013. <http://www.uniprot.org/uniprot/P0ACJ8>. ???Sequence Analysis.??? Reverse Translate. The Sequence Manipulation Suite, n.d. Web. 25 Oct. 2013. <http://www.bioinformatics.org/sms2/rev_trans.html>. This sensor should detect cAMP in media, activate cAMP regulator protein, and produce a PoPS signal, which then could be the input for an actuator, such as a Gemini reporter. false false _848_ 0 19061 9 Not in stock false The design behind using both a weak promoter and a weak RBS is intended to keep the E. coli alive since it is known that excessive concentrations of cAMP can be toxic to the cells. However, our second promoter is strong in order to increase our PoPS signal and give high expression of the actuator output. false Danielle Fraga, Jason Yang, Kaelo Moahi component2371601 1 BBa_M36544 component2371602 1 BBa_M36545 component2371599 1 BBa_M36541 component2371600 1 BBa_M36542 component2371603 1 BBa_M36546 annotation2371600 1 BBa_M36542 range2371600 1 48 135 annotation2371603 1 BBa_M36546 range2371603 1 855 904 annotation2371599 1 BBa_M36541 range2371599 1 1 47 annotation2371602 1 BBa_M36545 range2371602 1 766 854 annotation2371601 1 BBa_M36544 range2371601 1 136 765 BBa_M36542 1 BBa_M36542 BCD22 - RBS 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z Mutalek et. al. 2012 BioFab biofab.org/data (downloaded in csv format) BCD22 is a weak RBS for translation of RNA into the protein that will express GFP. false false _848_ 0 19061 9 Not in stock false We had to make sure we did not overexpress cAMP regulatory protein. false Danielle Fraga BBa_M36546 1 BBa_M36546 apFAB47 Promoter with DNA binding sequence from CRP 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ http://www.uniprot.org/uniprot/P0ACJ8 After CRP binds with cAmp, it binds to this specific DNA promoter between the -35 and -10 boxes. It is a strong promoter so that it makes a strong PoPS signal to initiate transcription of an actuator. false false _848_ 0 19061 9 Not in stock false Between the -35 box and the -10 box, we deleted the sequence from apFAB47 promoter and replaced it with the binding sequence that CRP will bind to. false Danielle Fraga BBa_M36541 1 BBa_M36541 apFAB49 Promoter activated by cAMP in E. Coli 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z BioFab http://io.biofab.org/services/studio/dac/ apFAB49 is a promoter that gives weak constitutive expression of downstream genes. It initiates transcription, which makes RNA. The promoter has a 94 Mean Fluorescence per Cell. false false _848_ 0 19061 9 Not in stock false We wanted a promoter that had weak expression so as to not kill the E. Coli cells with toxicity from overexpression of cAMP receptor protein. false Danielle Fraga BBa_M36547_sequence 1 aaaaagagtattgacttttatcccttgcggcgaatacttacagccatgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcctaggaagttttctaatgatggtgctgggcaaaccgcagaccgatccgaccctggaatggtttctgagccattgccatattcataaatatccgagcaaaagcaccctgattcatcagggcgaaaaagcggaaaccctgtattatattgtgaaaggcagcgtggcggtgctgattaaagatgaagaaggcaaagaaatgattctgagctatctgaaccagggcgattttattggcgaactgggcctgtttgaagaaggccaggaacgcagcgcgtgggtgcgcgcgaaaaccgcgtgcgaagtggcggaaattagctataaaaaatttcgccagctgattcaggtgaacccggatattctgatgcgcctgagcgcgcagatggcgcgccgcctgcaggtgaccagcgaaaaagtgggcaacctggcgtttctggatgtgaccggccgcattgcgcagaccctgctgaacctggcgaaacagccggatgcgatgacccatccggatggcatgcagattaaaattacccgccaggaaattggccagattgtgggctgcagccgcgaaaccgtgggccgcattctgaaaatgctggaagatcagaacctgattagcgcgcatggcaaaaccattgtggtgtatggcacccgctagagatcaagccttaacgaactaagacccccgcaccgaaaggtccgggggttttttttgaccttaaaaacataaccgaggagcagacaaaaaagagtattgactaaatgtgatctagatcacattttaattatttcat BBa_M36544_sequence 1 atggtgctgggcaaaccgcagaccgatccgaccctggaatggtttctgagccattgccatattcataaatatccgagcaaaagcaccctgattcatcagggcgaaaaagcggaaaccctgtattatattgtgaaaggcagcgtggcggtgctgattaaagatgaagaaggcaaagaaatgattctgagctatctgaaccagggcgattttattggcgaactgggcctgtttgaagaaggccaggaacgcagcgcgtgggtgcgcgcgaaaaccgcgtgcgaagtggcggaaattagctataaaaaatttcgccagctgattcaggtgaacccggatattctgatgcgcctgagcgcgcagatggcgcgccgcctgcaggtgaccagcgaaaaagtgggcaacctggcgtttctggatgtgaccggccgcattgcgcagaccctgctgaacctggcgaaacagccggatgcgatgacccatccggatggcatgcagattaaaattacccgccaggaaattggccagattgtgggctgcagccgcgaaaccgtgggccgcattctgaaaatgctggaagatcagaacctgattagcgcgcatggcaaaaccattgtggtgtatggcacccgc BBa_M36541_sequence 1 aaaaagagtattgacttttatcccttgcggcgaatacttacagccat BBa_M36545_sequence 1 tagagatcaagccttaacgaactaagacccccgcaccgaaaggtccgggggttttttttgaccttaaaaacataaccgaggagcagaca BBa_M36542_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcctaggaagttttctaatg BBa_M36546_sequence 1 aaaaagagtattgactaaatgtgatctagatcacattttaattatttcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z