BBa_M36923 1 BBa_M36923 Ferredoxin producing gene 2012-12-06T12:00:00Z 2015-05-08T01:14:07Z http://www.ncbi.nlm.nih.gov/gene/4260838 Produces ferredoxin, an iron-sulfur protein, which acts as an electron carrier in photosynthesis. Comes for Synnechococcus sp. CC9311. false false _848_ 0 15044 9 Not in stock false Optimized codon, G/C content, and repeats to 10 base pairs for S. elongatus false Christian Castaneda, Thai Nguyen, Andrew Rodriguez BBa_I716002 1 BBa_I716002 yfbE iron promoter basic part 2007-06-17T11:00:00Z 2015-08-31T04:07:50Z E. coli MG1665 Iron promoter false true _110_ 0 1812 9 Not in stock false Bbrick yfbE promoter [pcr] yfbE-F/R on E.coli MG1665 gen. (437bp, BglII/XhoI) [sub] into pBca9145-Bca1144#5 (BglII/XhoI, 2063+910, L) [prod] pBca9145-yfbE (I716002) --- AY005.yfbE-F cgacaAGATCTatgatatatttttttgacttc AY006.yfbE-R cttatCTCGAGttaGGATCCcgagttcctccacgcccattg false Arthur Yu BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_M36555 1 BBa_M36555 Ferredoxin-producing gene with iron sensor 2012-12-06T12:00:00Z 2015-05-08T01:14:05Z http://partsregistry.org/Part:BBa_J23119; http://partsregistry.org/Part:BBa_B0034; http://www.ncbi.nlm.nih.gov/gene/4260838; http://partsregistry.org/Part:BBa_B0015; http://partsregistry.org/Part:BBa_I716002 The ferredoxin, which is an iron-sulfur protein, is constitutively produced at high levels. Ferredoxin sequesters iron, so an iron sensor in the form of an iron-inducible promoter is put downstream of the ferredoxin gene. It may be possible to calculate the amount of ferredoxin produced by controlling the dissolved iron concentration and measuring the output of a reporter put downstream of the iron sensor. Comparing this result to a positive control of the reporter output of cultures with only the iron sensor would enable the calculation (part BBa_I716002). false false _848_ 0 15043 9 Not in stock false Optimized codons, G/C content, and repeats to 10 base pairs for S. elongatus. false Christian Castaneda, Thai Nguyen, Andrew Rodriguez component2213683 1 BBa_M36923 component2213691 1 BBa_I716002 component2213690 1 BBa_B0015 component2213682 1 BBa_B0034 component2213680 1 BBa_J23119 annotation2213691 1 BBa_I716002 range2213691 1 499 904 annotation2213680 1 BBa_J23119 range2213680 1 1 35 annotation2213683 1 BBa_M36923 range2213683 1 62 355 annotation2213690 1 BBa_B0015 range2213690 1 364 492 annotation2213682 1 BBa_B0034 range2213682 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_M36923_sequence 1 atgacgtcgttcaatgtccagctgatcaccccccagggggaggtctcgttccactgcccggatgatgagtacatcctggatgcggccgagcaggcgggcatcgatatgagctactcctgccgcgccggcgcctgctccagctgcgtcggccgcctcatccagggcaccctcgaccagtccgaccagagcttcctcgatgaggcgcagatcaaagataagtacgccctgctctgcgtcgcgtacgccacctccgatctcgtggtcaaaaccgattgcgaggaggagctctggtag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I716002_sequence 1 atgatatatttttttgacttcaacgaagagcggcaaaaagctaacacgtaaactccacctatagacaagcgcaaccagacaattaccgtgaaattgagctacatttctggcgataattcgcagttggtgtaatattaaaaatcctacgatgtcggcaaaatgcctcaaaattttgccaaatgcaaagcctaaataagaaaaaatataaaaatttcaatatttacgtctaatattagtttcttaaggttaagttaatattctatccttaaaatttcgctccaaatggcaaaatatacacaacactctttatagcaaatataagtggacaggtattcaatggcggaaggaaaagcaatgtcagaatttttgcctttttcgcgaccagcaatgggcgtggaggaactcg BBa_M36555_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgacgtcgttcaatgtccagctgatcaccccccagggggaggtctcgttccactgcccggatgatgagtacatcctggatgcggccgagcaggcgggcatcgatatgagctactcctgccgcgccggcgcctgctccagctgcgtcggccgcctcatccagggcaccctcgaccagtccgaccagagcttcctcgatgaggcgcagatcaaagataagtacgccctgctctgcgtcgcgtacgccacctccgatctcgtggtcaaaaccgattgcgaggaggagctctggtagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagatgatatatttttttgacttcaacgaagagcggcaaaaagctaacacgtaaactccacctatagacaagcgcaaccagacaattaccgtgaaattgagctacatttctggcgataattcgcagttggtgtaatattaaaaatcctacgatgtcggcaaaatgcctcaaaattttgccaaatgcaaagcctaaataagaaaaaatataaaaatttcaatatttacgtctaatattagtttcttaaggttaagttaatattctatccttaaaatttcgctccaaatggcaaaatatacacaacactctttatagcaaatataagtggacaggtattcaatggcggaaggaaaagcaatgtcagaatttttgcctttttcgcgaccagcaatgggcgtggaggaactcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z