BBa_M36556 1 BBa_M36556 5' Bicistronic UTR (medium), does not include ATG start 2012-12-04T12:00:00Z 2015-05-08T01:14:05Z The RBS was found in the biofab website ( http://io.biofab.org:5000/simple/bd_gois) under the tag BCD2. 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 15023 9 Not in stock false This specific RBS had a high expression of protein in whatever plasmid it was inserted in as observed from the data in http://io.biofab.org:5000/simple/bd_gois. It therefore guaranteed a high expression of our desired protein. false Elvis Ikwa BBa_M36556_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z