BBa_M36561 1 BBa_M36561 This terminator is a general terminator of transcription. It forms a stem loop which stops transcrip 2014-10-23T11:00:00Z 2015-05-08T01:14:05Z The source of this part is from the parts registry. It is known as BBa_B0010. This terminator is a general E. coli terminator that forms a 64 base pair stem loop. The structure of the stem loop arrests transcription of a gene. This basic part is to be added at the end of a gene to stop transcription. false false _848_ 0 24186 9 In stock false The reason we chose this part for our project is that it is a simple terminator and forms one stem loop. Nothing in the sequence was changed from the obtained version from the parts registry. false Ashley Henderson BBa_M36561_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z