BBa_M36576 1 BBa_M36576 qsc102 promoter + Whiteley Spacing 2015-10-21T11:00:00Z 2015-10-22T10:25:01Z qsc102 promoter: Boxed region from Figure 1 of http://www.ncbi.nlm.nih.gov/pmc/articles/PMC95443/ Whiteley spacing: Region following boxed region to bolded A of http://www.ncbi.nlm.nih.gov/pmc/articles/PMC95443/ Palindromic binding sequence and spacing for LasR bound to Pseudomonas Autoinducer. false false _848_ 29087 29087 9 false Added 11 preceding base pairs to qsc102 palindromic binding sequence in order to optimize LasR complex binding. false Elisa Vidales annotation2478312 1 LasR binding sequence range2478312 1 12 31 annotation2478320 1 Transcription Start Site range2478320 1 65 65 annotation2478319 1 Whiteley Spacing range2478319 1 32 64 annotation2478317 1 Binding Spacing 1 range2478317 1 1 11 BBa_M36576_sequence 1 tgaatcactagacctgcccggaagggcaggtgtccctgccgggctgtgacaatttaattcgacca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z