BBa_M36624 1 BBa_M36624 Antifungal protein from Aspergillus giganteus (active) 2015-10-21T11:00:00Z 2015-10-23T11:54:35Z http://onlinelibrary.wiley.com/doi/10.1111/j.1432-1033.1990.tb19300.x/full This links to the amino acid sequence, which we then entered into IDT Codon Optimizer to find the optimal corresponding DNA sequence in E. coli. This part codes for AFP, an antifungal protein produced naturally by Aspergillus giganteus, a mold species in the fungi kingdom. It appears to be involved in the inhibition of chitin synthesis, chitin being a key protein in the cell walls of fungi. It may also have other anti-fungal functions, but more research is necessary to determine its exact mode of action. false false _848_ 29100 29100 9 false The pre-protein is 94 amino acids long, but is cleaved before secretion into a 51 amino acid peptide that is now active. This part is for the 51 amino acid peptide plus a start codon. We have another part for the immature 94 amino acid peptide. false Jodie Sheffels, Benjamin Yeh, Ali Hoffer BBa_M36624_sequence 1 gccacctacaatggtaaatgctacaaaaaggataacatctgtaaatacaaagcgcagtccggcaaaaccgcaatttgcaaatgctatgtgaaaaaatgtccgcgtgatggagctaagtgcgagttcgacagctataaaggtaaatgttattgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z