BBa_M36624 1 BBa_M36624 Antifungal protein from Aspergillus giganteus (active) 2015-10-21T11:00:00Z 2015-10-23T11:54:35Z http://onlinelibrary.wiley.com/doi/10.1111/j.1432-1033.1990.tb19300.x/full This links to the amino acid sequence, which we then entered into IDT Codon Optimizer to find the optimal corresponding DNA sequence in E. coli. This part codes for AFP, an antifungal protein produced naturally by Aspergillus giganteus, a mold species in the fungi kingdom. It appears to be involved in the inhibition of chitin synthesis, chitin being a key protein in the cell walls of fungi. It may also have other anti-fungal functions, but more research is necessary to determine its exact mode of action. false false _848_ 29100 29100 9 false The pre-protein is 94 amino acids long, but is cleaved before secretion into a 51 amino acid peptide that is now active. This part is for the 51 amino acid peptide plus a start codon. We have another part for the immature 94 amino acid peptide. false Jodie Sheffels, Benjamin Yeh, Ali Hoffer BBa_M36630 1 BBa_M36630 AFP Protein with FLAG Epitope 2015-10-23T11:00:00Z 2015-10-24T05:39:27Z AFP protein derived from Aspergillus giganteus. See Part:BBa_M36624 for more details. Standard FLAG epitope. See Part:BBa_M36629 for more details. AFP antifungal protein (51 AA peptide) tagged at the C-terminus with a FLAG epitope. Note: No start codon included. false false _848_ 29103 29103 9 false The construct was made to be within a 1500bp limit with less than 5 repeats of >= 10bp, and no BsaI, BbsI, or BsmBI restriction sites. false Benjamin Yeh, Jodie Sheffels, Ali Hoffer component2478350 1 BBa_M36624 component2478351 1 BBa_M36629 annotation2478351 1 BBa_M36629 range2478351 1 162 185 annotation2478350 1 BBa_M36624 range2478350 1 1 153 BBa_M36629 1 BBa_M36629 FLAG Epitope 2015-10-23T11:00:00Z 2015-10-24T05:34:12Z The DNA sequence was generated from the amino acid sequence (DYKDDDDK) using IDT Codon Optimizer for E. coli K12. It was then modified to remove certain restriction sites and repeats. Encodes the FLAG epitope, which has the amino acid sequence of DYKDDDDK. Can be added to either the N- or C- terminus of a protein. No start codon included. false false _848_ 29103 29103 9 false 1. Avoid BsaI, BbsI, and BsmBI restriction sites 2. Avoid repeats over 10bp in length. false Benjamin Yeh, Jodie Sheffels, Ali Hoffer BBa_M36629_sequence 1 gattataaagatgacgacgacaag BBa_M36630_sequence 1 gccacctacaatggtaaatgctacaaaaaggataacatctgtaaatacaaagcgcagtccggcaaaaccgcaatttgcaaatgctatgtgaaaaaatgtccgcgtgatggagctaagtgcgagttcgacagctataaaggtaaatgttattgctactagaggattataaagatgacgacgacaag BBa_M36624_sequence 1 gccacctacaatggtaaatgctacaaaaaggataacatctgtaaatacaaagcgcagtccggcaaaaccgcaatttgcaaatgctatgtgaaaaaatgtccgcgtgatggagctaagtgcgagttcgacagctataaaggtaaatgttattgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z