BBa_M36631 1 BBa_M36631 AFP Preproprotein with FLAG Epitope 2015-10-23T11:00:00Z 2015-10-30T07:47:12Z AFP protein derived from Aspergillus giganteus. See Part:BBa_M36623 for more details. Standard FLAG epitope. See Part:BBa_M36629 for more details. AFP antifungal preproprotein (94 AA peptide) tagged at the C-terminus with a FLAG epitope false false _848_ 29103 29103 9 false The construct was made to be within a 1500bp limit with less than 5 repeats of >= 10bp, and no BsaI, BbsI, or BsmBI restriction sites. false Benjamin Yeh, Jodie Sheffels, Ali Hoffer component2478353 1 BBa_M36629 component2478352 1 BBa_M36623 annotation2478353 1 BBa_M36629 range2478353 1 291 314 annotation2478352 1 BBa_M36623 range2478352 1 1 282 BBa_M36629 1 BBa_M36629 FLAG Epitope 2015-10-23T11:00:00Z 2015-10-24T05:34:12Z The DNA sequence was generated from the amino acid sequence (DYKDDDDK) using IDT Codon Optimizer for E. coli K12. It was then modified to remove certain restriction sites and repeats. Encodes the FLAG epitope, which has the amino acid sequence of DYKDDDDK. Can be added to either the N- or C- terminus of a protein. No start codon included. false false _848_ 29103 29103 9 false 1. Avoid BsaI, BbsI, and BsmBI restriction sites 2. Avoid repeats over 10bp in length. false Benjamin Yeh, Jodie Sheffels, Ali Hoffer BBa_M36623 1 BBa_M36623 Antifungal protein from Aspergillus giganteus 2015-10-21T11:00:00Z 2015-10-22T05:42:16Z http://www.ncbi.nlm.nih.gov/pubmed/8082203 This part codes for an antifungal protein produced naturally by Aspergillus giganteus, a mold species in the fungi kingdom. It appears to be involved in the inhibition of chitin synthesis (chitin being a protein that fungi rely on to build their cell walls). We plan to produce this protein in E. coli for potential use in combating plant-pathogenic fungi. false false _848_ 29103 29100 9 false This pre-protein is 94 amino acids upon translation, but is later cleaved into a 51 amino acid-long peptide. This 51 amino acid version is the active version. false Jodie Sheffels, Benjamin Yeh, Ali Hoffer BBa_M36631_sequence 1 atgaaattcgtgagcttagcgtccctggggttcgccctcgtggccgccttgggcgcggtggctaccccggttgaagcagattcgctgaccgcgggtgggctggacgcgcgcgatgaatccgcggtactggccacttataatggtaaatgttacaaaaaagacaatatctgcaagtacaaagcacagagtggcaaaaccgcgatctgtaaatgctatgtgaaaaaatgcccgcgcgacggcgccaaatgtgagtttgacagctataaaggtaaatgctattgctactagaggattataaagatgacgacgacaag BBa_M36623_sequence 1 atgaaattcgtgagcttagcgtccctggggttcgccctcgtggccgccttgggcgcggtggctaccccggttgaagcagattcgctgaccgcgggtgggctggacgcgcgcgatgaatccgcggtactggccacttataatggtaaatgttacaaaaaagacaatatctgcaagtacaaagcacagagtggcaaaaccgcgatctgtaaatgctatgtgaaaaaatgcccgcgcgacggcgccaaatgtgagtttgacagctataaaggtaaatgctattgc BBa_M36629_sequence 1 gattataaagatgacgacgacaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z