BBa_M36658 1 BBa_M36658 mRNA Sequence for Acetoacetyl-CoA Reductase 2015-12-04T12:00:00Z 2015-12-04T06:52:29Z Part comes from the genomic sequence of Phaeobacter inhibens (strain ATCC 700781/DSM 17395/CIP 105210/NBRC 16654/BS107). Referenced http://www.uniprot.org/uniprot/G0CFI5 and http://www.google.com/patents/WO1995020621A1?cl=en, which both contributed to the discovery of the gene sequence for the necessary protein. Part codes for the mRNA sequence to produce acetoacetyl-CoA reductase, which synthesizes poly-3-hydroxybutyrate in from acetoacetyl-CoA. This composite part is the DNA sequence collected from an amino acid sequence obtained from Phaeobacter inhibens (strain ATCC 700781/DSM 17395/CIP 105210/NBRC 16654/BS107), specifically from the gene I7EIV2. Part is intended to be inserted into pD454-GST, with a high copy number and ampicillin resistance. Complete system should be transformed into E. Coli. false false _848_ 29108 29108 9 false Part was designed to meet the following conditions: be less than 1500 bp, avoid BbsI, BsaI, and BsmBI, and have less than five repeats 10 bp. There was an active attempt to avoid the restriction sites, stated above, that DNA 2.0 uses in the synthesis of DNA and to minimize repeats in the sequence to ensure success during synthesis. A limit of 1500 bp was imposed by the course. false Taylor Marie Chavez, Maria Iglesias, Alison Jahansouz BBa_M36658_sequence 1 atggcccgtaacgcgctggtcaccggcggtagtcgcgggatcggagcagccatctcacaggcgctgaaagcggagggctacaccgtggccgctacctacgctggcaatgacgaagcggcggcgaaattcacgaatgagactggcattaaaacatataaatgggatgttgcgagctatgaagattcggccgccggtatcgccaaggttgaagcggacattgggccgattgatattgttgtggcaaatgctgggattacccgtgatgctcccttccataaaatgacgctcgagcagtggcagcaggtcatagataccaacctcaccggtgtgtttaacaccgtgcatccgatctggcctggtatgcgcgaacgcaagttcggccgtgtgatcgtcatttcttccatcaacgggcaaaaagggcagtttgcgcaggtaaattatgcggctactaaagccggtgatcttggtatcgtgaaatccctggcgcaagaaggagctcgcgcgggcatcaccgccaatgccatttgccccggttatatcgcgacagaaatggtcatggccgttcctgaaaaggttcgtgagagcattatcggccagattcctgccggacgtttaggcgaacccgaagaaattgctcgttgcgtggcattcttggcgtccgaggactcgggctttattaacgggtctacaatcagcgcgaatggcgcccagtttttcgtataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z