BBa_M36661 1 BBa_M36661 E. coli fur protein 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z The fur protein amino acid sequence was confirmed in the RCSB Protein Data Bank [1]. References 1. RCSB Protein Data Bank htttp://www.rcsb.org/pdb/explore/sequenceText.do?structureId=2FU4&chainId=A. 2. Online DNA and Protein Sequence Optimizer http://genomes.urv.es/OPTIMIZER/ 3.Woestenenk, Esmeralda. ???His tag effect on solubility of human proteins produced in Escherichia coli: a comparison between four expression vectors." Journal of structural and functional genomics. Vol 5.3 217-229. 2004. Web. The fur protein is found in E. coli and is involved in iron regulation. The protein dimerizes in the presence of iron, thus inhibiting transcription. At the end of the fur protein, we included a his-tag to be used as the primary antibody binding site in a Western blot assay. The his-tag is also followed by a stop codon. false false _848_ 0 19047 9 Not in stock false Using an online DNA and Protein Sequence Optimizer tool [2], the amino acid sequence to a nucleotide sequence specific for K12 E. coli codons, using the favored codon 70.3% of the time. This optimization yielded a 52% GC content and a 48% AT content. In addition, a His-tag, used by Woestenek [3], which will be used as the primary antibody binding site if we need to conduct a Western blot assay. The fur protein was modified with a stop codon following the His-tag. false Frankie Willcox, Claudia Dennler, Meelim Lee BBa_M36661_sequence 1 actgacaacaacactgcactgaaaaaagctggcctgaaagtaacccttcctcgcctgaaaatcctggaagtgctgcaggaaccggacaaccaccacgtcagcgcagaagatctgtacaaacgcctgatcgacatgggggaggagatcggtctggcaaccgtctatcgtgttttgaatcagtttgacgacgcaggtatcgtgacccgccacaacttcgaaggcggtaaaagcgtctttgaactgacccaacagcaccaccacgatcacctgatctgcctggactgcggcaaagtgatcgaattcagcgacgatagtattgaagcacgtcagcgtgaaatcgctgcaaagcacggtatccgtttgacgaaccacagcctgtatctttacggccattgtgccgaaggtgattgccgtgaagatgagcacgcccacgaaggaaaacatcatcaccatcaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z