BBa_M36663 1 BBa_M36663 fur binding site, PopS repressor 2013-10-24T11:00:00Z 2015-05-08T01:14:05Z Sequence source: Lavrrar, Jennifer and Mark McIntosh. ???Architecture of Fur Binding Site: a Comparative Analysis???. Journal of Bacterial Biology.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC151488/. Web. Binding site for the dimerized form of the fur protein. Fur protein responds to ferrous iron ions and inhibits transcription. false false _848_ 0 19047 9 Not in stock false Substituted a 19 nucleotide long sequence between the -10 and -35 box to act as a binding site for dimerized fur protein. The original promoter came from biofab.org. false Frankie Willcox BBa_M36663_sequence 1 ttgacagataatgataatcattatctataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z