BBa_M36667 1 BBa_M36667 FNR-dependent Hypoxia Sensor 2014-05-05T11:00:00Z 2015-05-08T01:14:05Z 1. Unden, Gottfried, and Jan Schirawski. "The Oxygen-responsive Transcriptional Regulator FNR of Escherichia Coli: The Search for Signals and Reactions."Molecular Microbiology 25.02 (1997): 205-10. Web. <http://onlinelibrary.wiley.com/doi/10.1046/j.1365-2958.1997.4731841.x/pdf> 2. "Part:BBa_J23100.??? Registry of Standard Biological Parts. Web. <http://parts.igem.org/Part:BBa_J23100> 3. ???Part:BBa_B0015.??? Registry of Standard Biological Parts. Web. <http://parts.igem.org/Part:BBa_B0015> 4. Lombardo, Mary-Jane, Angela A. Lee, Tina M. Knox, and Charles G. Miller. "Regulation of the Salmonella Typhimurium PepT Gene by Cyclic AMP Receptor Protein (CRP) and FNR Acting at a Hybrid CRP-FNR Site."Journal Of Bacteriology 179.6 (1997): 1909-917. American Society for Microbiology. Web. 04 May 2014. <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC178913/pdf/1791909.pdf> This part utilizes fumarate nitrate reductase (FNR) transcription factor with E. Coli constitutive promoter, which regulates pepT7 promoter downstream with Gemini actuator. FNR and pepT7 promoter sequence are from Salmonella typhimurium, and the constitutive promoter, ribosome binding site, and terminator are generic E. Coli parts. FNR is regulated by O2: inactive when exposed to O2, and requires low O2 (hypoxia) and glutathione/cysteine desulfurase to reactivate, of which cysteine desulfurase is already present within E. Coli. Once activated, FNR induces the pepT7 promoter, which facilitates expression of the Gemini actuator. The lacZ portion of Gemini will produce beta-galactosidase, which can be qualitatively and quantitatively measured. false false _848_ 0 22287 9 Not in stock false Modifications were made to the FNR sequence: GAG to GAA at position 418 and ACG to ACA at 421 to remove a restriction site, BbsI, but preserve the amino acid sequence. false Steven Chen annotation2372934 1 pRBS-SD1 range2372934 1 31 37 annotation2372933 1 BBa_J23100 const. promoter range2372933 1 1 30 annotation2372935 1 FNR gene range2372935 1 44 796 annotation2372937 1 pepT7 FNR-inducible promoter range2372937 1 926 971 annotation2372936 1 BBa_B0015 terminator range2372936 1 797 925 BBa_M36667_sequence 1 ggctagctcagtcctaggtacagtgctagcaggaggaaaaaaatgatcccggaaaagcgaattatacggcgcattcagtctggcggttgtgctatccattgccaggattgcagtatcagccagctttgcatcccgttcacacttaacgagcatgagcttgatcagcttgataatatcatcgagcgcaaaaagcccattcagaaagggcaaactctgtttaaagcaggtgatgaactgaaatcgctctatgctatccgctccggaacgattaagagctacaccattaccgagcaaggcgatgagcagattactggattccatttagcaggcgacctggtgggttttgacgccattggcagcggtcatcatccgagctttgcacaggcgctggaaacctcaatggtatgtgaaatcccctttgaaacactggatgacctgtccggcaaaatgcctaacctgcgtcagcaaatgatgcgtctgatgagcggtgaaattaaaggcgatcaggatatgatcctgttattgtcgaagaaaaacgccgaagaacgtctggccgcgtttatttacaacctgtcccgccgctttgcgcagcgtggtttttcaccgcgtgaattccgcctgacgatgacccgtggcgatatcggcaactatctgggcttaacggtcgaaaccattagccgtctgctggggcgtttccagaaaagcggtatgctggcggtgaaaggtaagtatattactattgaaaacagcgatgcgctggcggccctcgccggtcatacccgcaacgtcgcttaaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataaaaagtgacctgacgcaatatttgtcttttcttgcttattaataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z