BBa_M36707 1 BBa_M36707 IclR binding sites on aceBAK promoter 2011-04-25T11:00:00Z 2015-05-08T01:14:06Z Genomic sequence coded by genome.jp IclR inhibits the aceBAK gene in conjunction with pyruvate or glyoxylate by binding these sites on the aceBAK promoter. false false _848_ 0 9650 9 Not in stock false Only considered IclR binding sites false Katie Lund, Wyatt Woodson annotation2119510 1 IclR Box IV range2119510 1 48 54 annotation2119513 1 IclR Box VI range2119513 1 110 116 annotation2119509 1 IclR Box III range2119509 1 30 36 annotation2119507 1 IclR Box I range2119507 1 11 17 annotation2119508 1 IclR Box II range2119508 1 21 27 annotation2119514 1 CRP-cAMP Binding Site range2119514 1 114 135 annotation2119512 1 IclR Box V range2119512 1 99 105 annotation2119515 1 IclR Box VII range2119515 1 118 124 annotation2119517 1 IclR Box VIII range2119517 1 126 131 annotation2119511 1 IHF Binding Site range2119511 1 76 89 annotation2119516 1 -35 Region range2119516 1 119 127 BBa_M36707_sequence 1 tacctcaggcaccttcgggtgccttttttatttccgaaacacacctcagtaggtgaataaattttattaatattgttatcaataagttatcaagtatttttaattaaaatggaaattgtttttgattttgatttttaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z