BBa_M36001 1 BBa_M36001 5' Bicistronic UTR (medium), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Vivek Mutalik et al. c/o BIOFAB Emeryville. 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false Please see long description. false Drew Endy BBa_M36706 1 BBa_M36706 Gene encoding IclR 2011-04-25T11:00:00Z 2015-05-08T01:14:06Z This coding sequence was obtained from genome.jp IclR represses the aceBAK promoter in E. coli false false _848_ 0 9650 9 Not in stock false none false Katie Lund and Wyatt Woodson annotation2119104 1 Start Codon range2119104 1 1 3 annotation2119109 1 Stop Codon range2119109 1 823 825 annotation2119221 1 IclR Coding Region range2119221 1 1 825 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_M36708 1 BBa_M36708 Pyruvate Sensor 2011-04-25T11:00:00Z 2015-05-08T01:14:06Z Katie Lund and Wyatt Woodson parts obtained from Stanford BIOE44 - S11 IclR binds with pyruvate to form a more stable structure to bind to the inhibitory regulation sites on the aceBAK promoter. By combining the IclR gene and the aceBAK promoter the presence of IclR and pyruvate will inhibit the aceBAK promoter and any genes downstream of it. While there will be some residual transcription in the presence of only IclR, the presence of pyruvate increases the stability of binding with the aceBAK promoter region so inhibitory activities are higher. false false _848_ 0 9650 9 Not in stock false a lot false Katie Lund and Wyatt Woodson component2119519 1 BBa_J23119 component2119537 1 BBa_M36707 component2119520 1 BBa_M36001 component2119525 1 BBa_M36010 component2119524 1 BBa_M36706 annotation2119519 1 BBa_J23119 range2119519 1 1 35 annotation2119525 1 BBa_M36010 range2119525 1 908 989 annotation2119520 1 BBa_M36001 range2119520 1 36 82 annotation2119537 1 BBa_M36707 range2119537 1 990 1131 annotation2119524 1 BBa_M36706 range2119524 1 83 907 BBa_M36707 1 BBa_M36707 IclR binding sites on aceBAK promoter 2011-04-25T11:00:00Z 2015-05-08T01:14:06Z Genomic sequence coded by genome.jp IclR inhibits the aceBAK gene in conjunction with pyruvate or glyoxylate by binding these sites on the aceBAK promoter. false false _848_ 0 9650 9 Not in stock false Only considered IclR binding sites false Katie Lund, Wyatt Woodson annotation2119513 1 IclR Box VI range2119513 1 110 116 annotation2119510 1 IclR Box IV range2119510 1 48 54 annotation2119517 1 IclR Box VIII range2119517 1 126 131 annotation2119507 1 IclR Box I range2119507 1 11 17 annotation2119508 1 IclR Box II range2119508 1 21 27 annotation2119516 1 -35 Region range2119516 1 119 127 annotation2119515 1 IclR Box VII range2119515 1 118 124 annotation2119511 1 IHF Binding Site range2119511 1 76 89 annotation2119509 1 IclR Box III range2119509 1 30 36 annotation2119512 1 IclR Box V range2119512 1 99 105 annotation2119514 1 CRP-cAMP Binding Site range2119514 1 114 135 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36001_sequence 1 tatagagggtattaataatgtatggattaaagggggaggcataacaa BBa_M36708_sequence 1 ttgacagctagctcagtcctaggtataatgctagctatagagggtattaataatgtatggattaaagggggaggcataacaaatggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgccaccgcaccagcgactggacaggttcagtctttaacgcgtggcctgaaattactggagtggattgccgaatccaatggcagtgtggcactcacggagctggcgcaacaagccgggttacccaattccacgacccaccgcctgctaaccacgatgcaacagcagggtttcgtgcgtcaggttggcgaactgggacactgggcaatcggcgcacatgcctttatggtcggcagcagctttctccagagccgtaatttgttagcaattgttcaccctatcctgcgcaatctaatggaagagtctggcgaaacggtcaatatggcggtgcttgatcaaagcgatcacgaagcgattattatcgaccaggtacagtgtacgcatctgatgcgaatgtccgcgcctatcggcggtaaattgccgatgcacgcttccggtgcgggtaaagcctttttagcccaactgagcgaagaacaggtgacgaagctgctgcaccgcaaagggttacatgcctatacccacgcaacgctggtgtctcctgtgcatttaaaagaagatctcgcccaaacgcgcaaacggggttattcatttgacgatgaggaacatgcgctggggctacgttgccttgcagcgtgtattttcgatgagcaccgtgaaccgtttgccgcaatttctatttccggaccgatttcacgtattaccgatgaccgcgtgaccgagtttggcgcgatggtgattaaagcggcgaaggaagtgacgctggcgtacggtggaatgcgctgatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtctacctcaggcaccttcgggtgccttttttatttccgaaacacacctcagtaggtgaataaattttattaatattgttatcaataagttatcaagtatttttaattaaaatggaaattgtttttgattttgatttttaaatga BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36706_sequence 1 atggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgccaccgcaccagcgactggacaggttcagtctttaacgcgtggcctgaaattactggagtggattgccgaatccaatggcagtgtggcactcacggagctggcgcaacaagccgggttacccaattccacgacccaccgcctgctaaccacgatgcaacagcagggtttcgtgcgtcaggttggcgaactgggacactgggcaatcggcgcacatgcctttatggtcggcagcagctttctccagagccgtaatttgttagcaattgttcaccctatcctgcgcaatctaatggaagagtctggcgaaacggtcaatatggcggtgcttgatcaaagcgatcacgaagcgattattatcgaccaggtacagtgtacgcatctgatgcgaatgtccgcgcctatcggcggtaaattgccgatgcacgcttccggtgcgggtaaagcctttttagcccaactgagcgaagaacaggtgacgaagctgctgcaccgcaaagggttacatgcctatacccacgcaacgctggtgtctcctgtgcatttaaaagaagatctcgcccaaacgcgcaaacggggttattcatttgacgatgaggaacatgcgctggggctacgttgccttgcagcgtgtattttcgatgagcaccgtgaaccgtttgccgcaatttctatttccggaccgatttcacgtattaccgatgaccgcgtgaccgagtttggcgcgatggtgattaaagcggcgaaggaagtgacgctggcgtacggtggaatgcgctga BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_M36707_sequence 1 tacctcaggcaccttcgggtgccttttttatttccgaaacacacctcagtaggtgaataaattttattaatattgttatcaataagttatcaagtatttttaattaaaatggaaattgtttttgattttgatttttaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z