BBa_M36724 1 BBa_M36724 5' Bicistronic UTR (strong), does not include ATG start 2011-04-27T11:00:00Z 2015-05-08T01:14:06Z Vivek Mutalik et al. c/o BIOFAB Emeryville. 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false Vivek says, "This is (the) Makoff design, it gives good expression and is seq independent of the Schoner design." false Drew Endy BBa_M36724_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcacaggagactttctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z