BBa_M36009 1 BBa_M36009 5' Bicistronic UTR (strong), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false please see long description. false Drew Endy BBa_M36042 1 BBa_M36042 EfeU elemental iron (II) transporter 2011-04-30T11:00:00Z 2015-05-08T01:14:02Z From wild-type Nissle 1917 E. coli. The sequence came from the Ecogene entry EG13860. This is the reconstructed gene for the EfeU iron transporter. This gene is inactive in K-12 strain E. coli, but has been characterized in the Nissle 1917 strain. (Grobe, Scherer et al. PMID: 16987175.) false false _848_ 0 9545 9 Not in stock false The sequence was conceptually reconstructed from the frame-shifted version. The Ecogene entry has an "N" for the nucleotide which is uncertain, but a comment in that entry says that the correct amino acid is likely glycine. Thus we chose N = G in the final sequence. false Tom McLaughlin annotation2119198 1 Repaired frameshift (see notes) range2119198 1 106 106 annotation2119195 1 REGLE motif range2119195 1 385 399 annotation2119197 1 Stop codon range2119197 1 829 831 annotation2119177 1 REGLE motif range2119177 1 28 42 annotation2119094 1 Start codon range2119094 1 1 3 BBa_M36728 1 BBa_M36728 EfeU elemental iron (II) transporter + 5' UTR (strong) + terminator 2011-05-01T11:00:00Z 2015-05-08T01:14:06Z Source: basic parts. This composite part has the EfeU iron transporter downstream from a strong 5' Bicistronic UTR. There is a terminator at the end. false false _848_ 0 9545 9 Not in stock false We are hoping that this 5' UTR will cause enough expression of the EfeU protein to measure, without producing so much that the organism dies due to excessive iron uptake or other ion imbalances. false Tom McLaughlin component2118527 1 BBa_M36010 component2118526 1 BBa_M36042 component2118525 1 BBa_M36009 annotation2118526 1 BBa_M36042 range2118526 1 48 878 annotation2118527 1 BBa_M36010 range2118527 1 879 960 annotation2118525 1 BBa_M36009 range2118525 1 1 47 BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36728_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaaatgtttgttccgtttctcattatgttgcgcgaaggacttgaagccgcgctgattgtcagtttgattgccagctatcttaagcgtacccagcgaggccgatggattggtgtgatgtggattggcgtgttgcttgccgctgcgttgtgcctgggcttgggtatcttcattaacgaaaccaccggcgaatttccgcaaaaagaacaggaactgtttgaaggtatcgtggcggtgatcgccgtggtgatccttacctggatggttttctggatgcgcaaagtgtcgcgcaacgtcaaagtgcaactggaacaggcagtcgatagcgcattgcagcgtggaaatcatcatggctgggcgctggtgatgatggtcttttttgccgttgcaagggaagggctggagtcggtctttttcctgctggcggcatttcaacaagatgtcgggatctggccgccgctgggtgcaatgctcggtcttgctactgccgtggtgctaggcttcctgctctactggggcggtattcgcctcaatcttggtgcattttttaaatggaccagcctgtttattctcttcgtcgccgcagggctggcagctggtgccattcgcgcatttcatgaagccggattgtggaaccactttcaggaaatcgccttcgatatgagtgcggtgctctcaactcactcgctgtttggcacgctgatggaagggatttttggctatcaggaagcgccgagcgtcagcgaagtcgccgtctggtttatttatctcatcccggcgctggtggcatttgctctgccaccacgcgcaggggcgacagcgtctcgctccgcgtaatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_M36009_sequence 1 tatagagggtattaataatgtatggattaaaaggggaggtataacaa BBa_M36042_sequence 1 atgtttgttccgtttctcattatgttgcgcgaaggacttgaagccgcgctgattgtcagtttgattgccagctatcttaagcgtacccagcgaggccgatggattggtgtgatgtggattggcgtgttgcttgccgctgcgttgtgcctgggcttgggtatcttcattaacgaaaccaccggcgaatttccgcaaaaagaacaggaactgtttgaaggtatcgtggcggtgatcgccgtggtgatccttacctggatggttttctggatgcgcaaagtgtcgcgcaacgtcaaagtgcaactggaacaggcagtcgatagcgcattgcagcgtggaaatcatcatggctgggcgctggtgatgatggtcttttttgccgttgcaagggaagggctggagtcggtctttttcctgctggcggcatttcaacaagatgtcgggatctggccgccgctgggtgcaatgctcggtcttgctactgccgtggtgctaggcttcctgctctactggggcggtattcgcctcaatcttggtgcattttttaaatggaccagcctgtttattctcttcgtcgccgcagggctggcagctggtgccattcgcgcatttcatgaagccggattgtggaaccactttcaggaaatcgccttcgatatgagtgcggtgctctcaactcactcgctgtttggcacgctgatggaagggatttttggctatcaggaagcgccgagcgtcagcgaagtcgccgtctggtttatttatctcatcccggcgctggtggcatttgctctgccaccacgcgcaggggcgacagcgtctcgctccgcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z