BBa_M36762 1 BBa_M36762 Chicken Lysozyme C (LYZ) conjugated with Albumin Signal Peptide 2014-10-22T11:00:00Z 2015-05-08T01:14:06Z The gene comes from iGem Part:BBa_K284001, a chicken lysozyme LysA gene. The signal peptide comes from Oxford Genetics optimized yeast lysozyme secretion vector, pSF-TEF1-NH2-Lys. Our part can be transformed into yeast for the production of mammalian lysozyme. Chicken lysozyme (LysA) has been shown to have high catalytic activity against gram-positive bacteria, hydrolyzing the peptidoglycan in the bacterial cell wall. The albumin signal peptide is optimized for lytic enzyme secretion in yeast expression hosts. By granting ethanologens, like yeast, the ability to secrete lysozyme, this part can be used to simultaneously decontaminate broths while carrying out fermentation. false false _848_ 0 24183 9 Not in stock false We checked to make sure the sequence did not include any BsaI restriction sites. Given that the signal peptide is derived from mammalian cells, it is uncertain whether or not the yeast will read the peptide and secrete the lysozyme properly from the cytosol, despite it being yeast optimized. false Andrew Lee, Clinton Olivas, Daniel Hu annotation2429017 1 Start range2429017 1 1 3 annotation2429016 1 LYZ range2429016 1 56 444 annotation2429018 1 Stop range2429018 1 442 444 annotation2429015 1 Albumin signal peptide range2429015 1 1 55 BBa_M36762_sequence 1 atgaaatgggtgacctttatatctcttctctttttattcagctctgcttattcaaaggtatttgggaggtgtgagcttgccgctgctatgaagcgacacggattagacaactatcgaggatactccctcggtaattgggtttgtgctgcaaagtttgaaagtaactttaatacccaagccacgaatagaaatacagacgggtcaactgattacgggatccttcagataaatagcaggtggtggtgcaatgacggccgcactccaggatcacgtaatctttgcaacattccatgctcggcgttactttcgagtgacatcacagcgtcagtaaattgcgctaagaagatcgtgagtgatggcaatggcatgaacgcttgggtggcgtggcggaacaggtgtaaaggaacggacgttcaggcttggattagggggtgccggctctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z