BBa_M36771 1 BBa_M36771 Strong RBS from DNA 2.0 Gene Designer 2014-10-22T11:00:00Z 2015-05-08T01:14:06Z DNA 2.0 Gene Designer Strong Ribosome Binding Site from DNA 2.0 Gene Designer. false false _848_ 0 24189 9 Not in stock false None. false Preston Lim BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_M36772 1 Aegis Detergent Resistance Actuator 2014-10-22T11:00:00Z 2015-05-08T01:14:06Z BioCyc, Gene Designer from DNA 2.0, and iGEM The detergent resistance actuator comprises a ClpP gene downstream of a L-Rhamnose inducible promoter and a strong T7 RBS. The gene is terminated by a strong T7 terminator. false false _848_ 0 24189 9 Not in stock true Screening for BamHI, BbsI, and palindromic sequences of above 10bp. false Preston Lim component2429004 1 BBa_M36771 component2429003 1 BBa_K914003 component2429005 1 BBa_M36770 component2429006 1 BBa_B0012 annotation2429005 1 BBa_M36770 range2429005 1 150 773 annotation2429004 1 BBa_M36771 range2429004 1 131 143 annotation2429006 1 BBa_B0012 range2429006 1 782 822 annotation2429003 1 BBa_K914003 range2429003 1 1 122 BBa_M36770 1 BBa_M36770 ClpP Actuator 2014-10-22T11:00:00Z 2015-05-08T01:14:06Z EcoCyc: http://biocyc.org/ECOLI/sequence?object=EG10158 ClpP protease containing the catalytic site for the ClpAP and ClpXP protease complex. false false _848_ 0 24189 9 Not in stock false We had to make sure to screen for BamHI and BbsI restriction sites, and palindromic sequences of above 10 bp. false Preston Lim BBa_K914003 1 BBa_K914003 L-rhamnose-inducible promoter (pRha) 2012-09-19T11:00:00Z 2015-05-08T01:13:45Z Amplification of the plasmid pJOE3075 (Dr. Altenbuchner). Released HQ 2013 L-rhamnose-inducible promoter is capable of high-level recombinant protein expression in the presence of L-rhamnose, it is also tightly regulated in the absence of L-rhamnose by the addition of D-glucose. false false _1179_ 0 13487 9 In stock true One base pair modified (90: A -> T) to avoid EcoRI site. Mutation made in a less conserved base pair. false Denis Samuylov annotation2188559 1 pRha range2188559 1 1 122 BBa_M36770_sequence 1 atgagctattctggcgaacgcgacaactttgcaccacacatggcactggttccgatggttattgagcagacctcccgcggtgaacgttcgtttgacatctacagccgtctgctgaaggaacgtgtcattttcctgacgggccaagttgaggaccacatggcaaacctgattgtggcgcaaatgctgttcttggaagccgagaatccggagaaagacatctatttgtacatcaatagcccgggtggcgtcatcaccgcgggtatgagcatctacgatacgatgcagttcattaagcctgatgtgagcaccatttgcatgggtcaagcggcgagcatgggcgcgtttctgctgacggccggtgcgaaaggtaaacgtttttgtctgccgaattcccgtgtgatgatccatcagccgctgggtggctaccagggtcaggcgaccgatattgagatccacgctcgtgagattctgaaagttaagggccgcatgaacgaactgatggcactgcacactggtcagagcttggagcaaattgaacgcgataccgagcgcgatcgtttcctgagcgccccggaagctgtggagtatggtctggtcgacagcatcctgacccatcgtaactaa BBa_M36771_sequence 1 aggaggtaaaaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_M36772_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaatactagagaggaggtaaaaaatactagatgagctattctggcgaacgcgacaactttgcaccacacatggcactggttccgatggttattgagcagacctcccgcggtgaacgttcgtttgacatctacagccgtctgctgaaggaacgtgtcattttcctgacgggccaagttgaggaccacatggcaaacctgattgtggcgcaaatgctgttcttggaagccgagaatccggagaaagacatctatttgtacatcaatagcccgggtggcgtcatcaccgcgggtatgagcatctacgatacgatgcagttcattaagcctgatgtgagcaccatttgcatgggtcaagcggcgagcatgggcgcgtttctgctgacggccggtgcgaaaggtaaacgtttttgtctgccgaattcccgtgtgatgatccatcagccgctgggtggctaccagggtcaggcgaccgatattgagatccacgctcgtgagattctgaaagttaagggccgcatgaacgaactgatggcactgcacactggtcagagcttggagcaaattgaacgcgataccgagcgcgatcgtttcctgagcgccccggaagctgtggagtatggtctggtcgacagcatcctgacccatcgtaactaatactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K914003_sequence 1 ccacaattcagcaaattgtgaacatcatcacgttcatctttccctggttgccaatggcccattttcctgtcagtaacgagaaggtcgcgtattcaggcgctttttagactggtcgtaatgaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z