BBa_M36050 1 BBa_M36050 LexA gene 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z escherichia coli k-12 LexA is a repressor that represses SOS response genes coding for DNA polymerases required for repairing DNA damage. false false _848_ 0 9234 9 Not in stock false N/A false Ryan Kent, Evan Clark annotation2119199 1 start range2119199 1 1 1 annotation2119200 1 stop range2119200 1 609 609 annotation2118549 1 lexA range2118549 1 1 609 BBa_M36777 1 BBa_M36777 DNA damage sensor with weak LexA generator 2011-05-02T11:00:00Z 2015-05-08T01:14:06Z LexA gene and promoter from E. coli genome, other parts from registry Same as our BBa_M36053 DNA damage sensor, but using a weaker 5' UTR in the LexA generator so not as much LexA is generated. false false _833_848_ 0 9303 9 Not in stock false This sensor with a weaker LexA generator is another candidate for level matching with the Gemini actuator we will attach to the damage sensor. false Evan Clark component2118594 1 BBa_M36050 component2118596 1 BBa_M36051 component2118592 1 BBa_J23106 component2118593 1 BBa_M36000 component2118595 1 BBa_M36010 annotation2118592 1 BBa_J23106 range2118592 1 1 35 annotation2118595 1 BBa_M36010 range2118595 1 692 773 annotation2118594 1 BBa_M36050 range2118594 1 83 691 annotation2118596 1 BBa_M36051 range2118596 1 774 868 annotation2118593 1 BBa_M36000 range2118593 1 36 82 BBa_M36051 1 BBa_M36051 LexA regulated promoter 2011-05-01T11:00:00Z 2015-05-08T01:14:02Z escherichia coli k -12 This is the promoter sequence for the LexA gene. The lexA protein regulates its own promoter. There is a common binding site for the lexA protein found in this promoter that is also found in ~40 other SOS genes. false true _848_ 0 9234 9 Not in stock false We know exactly were the lexA protein binds, but we are not entirely sure of the exact deliniation of the promoter itself. Therefore this sequence may contain superfluous information. false Ryan Kent annotation2119366 1 lexA binding range2119366 1 65 68 annotation2119367 1 8 nt spacer range2119367 1 69 76 annotation2119368 1 lexA binding range2119368 1 77 80 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_M36000 1 BBa_M36000 5' Bicistronic UTR (weak), does not include ATG start 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z c/o Vivek Mutalik et al. BIOFAB Emeryville 5' UTR based on bicistronic junction architecture. First RBS is strong and drives expression of short leader cistron. Second RBS internal to first cistron control translation of gene of interest. Architecture is optimized so that downstream CDS for gene of interest does not have a chance to form a secondary structure with the 5' UTR. See BIOFAB.org for more information. false false _848_ 0 52 432 Not in stock false Please see the long description. false Drew Endy BBa_M36010 1 BBa_M36010 Transcription Terminator (Strong) 2011-04-25T11:00:00Z 2015-05-08T01:14:02Z Guillaume Cambray et al. c/o BIOFAB Emeryville E. coli RNA pol transcription terminator designed and tested by Guillaume Cambray at BIOFAB Emeryville. Based on the natural E. coli rnpB T1 terminator. false true _848_ 0 52 432 Not in stock false please see long description false Drew Endy BBa_M36777_sequence 1 tttacggctagctcagtcctaggtatagtgctagctatagagggtattaataatgtatggattaaagccggaaacataacaaatgaaagcgttaacggccaggcaacaagaggtgtttgatctcatccgtgatcacatcagccagacaggtatgccgccgacgcgtgcggaaatcgcgcagcgtttggggttccgttccccaaacgcggctgaagaacatctgaaggcgctggcacgcaaaggcgttattgaaattgtttccggcgcatcacgcgggattcgtctgttgcaggaagaggaagaagggttgccgctggtaggtcgtgtggctgccggtgaaccacttctggcgcaacagcatattgaaggtcattatcaggtcgatccttccttattcaagccgaatgctgatttcctgctgcgcgtcagcgggatgtcgatgaaagatatcggcattatggatggtgacttgctggcagtgcataaaactcaggatgtacgtaacggtcaggtcgttgtcgcacgtattgatgacgaagttaccgttaagcgcctgaaaaaacagggcaataaagtcgaactgttgccagaaaatagcgagtttaaaccaattgtcgttgaccttcgtcagcagagcttcaccattgaagggctggcggttggggttattcgcaacggcgactggctgtaatcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtccccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac BBa_M36051_sequence 1 cccttccagaattcgataaatctctggtttattgtgcagtttatggttccaaaatcgccttttgctgtatatactcacagcataactgtatatac BBa_M36010_sequence 1 tcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtc BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_M36050_sequence 1 atgaaagcgttaacggccaggcaacaagaggtgtttgatctcatccgtgatcacatcagccagacaggtatgccgccgacgcgtgcggaaatcgcgcagcgtttggggttccgttccccaaacgcggctgaagaacatctgaaggcgctggcacgcaaaggcgttattgaaattgtttccggcgcatcacgcgggattcgtctgttgcaggaagaggaagaagggttgccgctggtaggtcgtgtggctgccggtgaaccacttctggcgcaacagcatattgaaggtcattatcaggtcgatccttccttattcaagccgaatgctgatttcctgctgcgcgtcagcgggatgtcgatgaaagatatcggcattatggatggtgacttgctggcagtgcataaaactcaggatgtacgtaacggtcaggtcgttgtcgcacgtattgatgacgaagttaccgttaagcgcctgaaaaaacagggcaataaagtcgaactgttgccagaaaatagcgagtttaaaccaattgtcgttgaccttcgtcagcagagcttcaccattgaagggctggcggttggggttattcgcaacggcgactggctgtaa BBa_M36000_sequence 1 tatagagggtattaataatgtatggattaaagccggaaacataacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z