BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_M36761 1 MDA Melamine deaminase coding sequence 2013-06-09T11:00:00Z 2015-05-08T01:14:06Z The original gene coding for the protein of interest was isolated from a species of Pseudomonas (http://www.ncbi.nlm.nih.gov/nuccore/11890744). This part is the coding sequence for the enzyme melamine deaminase, optimized for usage in E. coli. This enzyme eliminates an amine group from melamine to produce ammonia and ammeline and is able to remove another amine group at a rate 10 times slower than the first reaction to bring the compound to ammelide. The enzyme does not react to a measurable extent with this last compound, so it metabolizes melamine by consecutive and predictable deaminations. false false _848_ 0 17944 9 Not in stock false The TriA gene???s codons were modified from the original and optimized for E. coli to a Codon Adaptation Index (CAI) of .76. After that, some palindromic and mRNA destabilizing sequences were removed to increase the stability of our DNA during synthesis. false Ray Paul Laureano-Mercado & Mark Kirollos annotation2329382 1 Stop (TAG) range2329382 1 1423 1425 annotation2329381 1 Start (ATG) range2329381 1 1 3 annotation2329380 1 Melamine Deaminase range2329380 1 1 1422 BBa_M36782 1 Mdaa PoPS -> Melamine deaminase 2013-06-09T11:00:00Z 2015-05-08T01:14:06Z The original gene coding for the protein of interest was isolated from a species of Pseudomonas (http://www.ncbi.nlm.nih.gov/nuccore/11890744). The sequences for the RBS and Terminator were sourced from BIOFAB (http://biofab.org/) This actuator's purpose is to code for the output of the enzyme melamine deaminase. This enzyme eliminates an amine group from melamine to produce ammonia and ammeline and is able to remove another amine group at a rate 10 times slower than the first reaction to bring the compound to ammelide. The enzyme does not react to a measurable extent with this last compound, so it metabolizes melamine by consecutive and predictable deaminations. Its design comprises three components, which include a bicistronic ribosome binding site, the MDA gene of interest which codes from melamine deaminase, and a transcription terminator. The part needs a PoPS signal as an input in order to produce the desired enzyme and was designed to work in E. coli. false false _848_ 0 17944 9 Not in stock false The TriA gene???s codons were modified from the original sequence and optimized for E. coli to a Codon Adaptation Index (CAI) of .76 (Puigb??, P., Guzm??n, E., Romeu, A. & Garcia-Vallv??, S. OPTIMIZER: A web server for optimizing the codon usage of DNA sequences. Nucleic Acids Research. 2007;35:W126???31.). After that, some palindromic and mRNA destabilizing sequences were removed to increase the stability of our DNA during synthesis. The sequence shown maintains a CAI of .76 and the same amino acid sequence as the original TriA gene. false Ray Paul Laureano-Mercado & Mark Kirollos component2329375 1 BBa_B1002 component2329370 1 BBa_M36761 component2329369 1 BBa_M36236 annotation2329370 1 BBa_M36761 range2329370 1 86 1510 annotation2329369 1 BBa_M36236 range2329369 1 1 85 annotation2329375 1 BBa_B1002 range2329375 1 1511 1544 BBa_M36236 1 BBa_M36236 5' Bicistronic UTR (no ATG) 2011-12-10T12:00:00Z 2015-05-08T01:14:04Z BIOFAB part id: apFAB563 This is a 5' UTR that uses bicistronic junction architecture to tightly control translation. It contains two ribosome binding sites: one to control the gene of interest, and another to synthesize a short leader protein. The latter cistron's translation prevents the former RBS from forming a secondary structure with the gene of interest. NOTE: The part BBa_M36282 is identical to this one and was submitted by a member of the same group. It is recommended that the instructors of this group deprecate one of the duplicates. false true _848_ 0 11064 9 Not in stock false Obtained from BIOFAB.org false Lawrence Xing BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_M36236_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttcta BBa_M36782_sequence 1 gggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgctaaggaggttttctaatgcaaactctgtctattcagcatggtaccctggtaacaatggatcagtaccgtcgcgttctgggcgacagctgggtgcatgtacaggatggtcgtattgttgctctgggtgtgcacgcagaaagcgttccaccgccggcggatcgtgtaatcgacgctcgtggtaaagttgtactgccgggcttcattaacgctcatactcacgttaaccagatcctgctgcgcggtggtccgtcccatgggcgccagttatatgattggctgttcaatgttctgtatccaggtcagaaagcaatgcgtccggaagatgttgcggtggcagtgcgtctttattgtgctgaggccgttcgctccggcatcaccacgattaacgataacgcggactccgcaatctatccgggtaacatcgaagcggcaatggcggtgtacggggaagtgggtgtacgtgttgtttacgcgcgcatgtttttcgatcgcatggacggccgcatccaaggctatgttgacgcgctgaaagcacgttcaccgcaggtggagctgtgctctatcatggaggaaacggccgtcgcgaaagatcgtatcactgcgctgtctgaccagtatcacggtaccgcgggcggtcgtatcagcgtgtggccagccccggctatcaccccggcggttaccgttgaaggtatgcgttgggcacaggcattcgcgcgcgaccgcgccgtaatgtggaccctgcacatggcggagagcgatcatgatgaacgtctgcactggatgtcgccggctgaatacatggagtgttacggtttactggacgagcgcctgcaggtcgcccattgtgtttacttcgatcgcaaggacgttcgcctgctgcatcgccacaacgtaaaggttgcttctcaggttgttagcaatgcgtatctgggttccggcgttgcgccggttccggaaatggtagaacgtggtatggccgttggtattggtaccgatgatggcaactgcaacgattccgtgaacatgattggcgatatgaagttcatggctcacattcatcgtgcagtacaccgcgacgcagacgttctgaccccggaaaagatcctggaaatggccaccatcgacggtgcgcgcagtctgggcatggaccatgaaattggcagcatcgaaaccggcaaacgtgctgacctgattctgctggatctgcgtcacccgcaaactaccccgcaccaccacctggcagctaccatcgtgtttcaggcatacggtaacgaagttgacaccgttttgatcgacggtaacgtcgtgatggaaaaccgccgtctgtcatttctgccgccggaacgtgaactggcttttctggaagaagctcagtcccgtgccactgcgatcctgcagcgtgcaaacatggttgcgaacccggcttggcgtagcctgtagcgcaaaaaaccccgcttcggcggggttttttcgc BBa_M36761_sequence 1 atgcaaactctgtctattcagcatggtaccctggtaacaatggatcagtaccgtcgcgttctgggcgacagctgggtgcatgtacaggatggtcgtattgttgctctgggtgtgcacgcagaaagcgttccaccgccggcggatcgtgtaatcgacgctcgtggtaaagttgtactgccgggcttcattaacgctcatactcacgttaaccagatcctgctgcgcggtggtccgtcccatgggcgccagttatatgattggctgttcaatgttctgtatccaggtcagaaagcaatgcgtccggaagatgttgcggtggcagtgcgtctttattgtgctgaggccgttcgctccggcatcaccacgattaacgataacgcggactccgcaatctatccgggtaacatcgaagcggcaatggcggtgtacggggaagtgggtgtacgtgttgtttacgcgcgcatgtttttcgatcgcatggacggccgcatccaaggctatgttgacgcgctgaaagcacgttcaccgcaggtggagctgtgctctatcatggaggaaacggccgtcgcgaaagatcgtatcactgcgctgtctgaccagtatcacggtaccgcgggcggtcgtatcagcgtgtggccagccccggctatcaccccggcggttaccgttgaaggtatgcgttgggcacaggcattcgcgcgcgaccgcgccgtaatgtggaccctgcacatggcggagagcgatcatgatgaacgtctgcactggatgtcgccggctgaatacatggagtgttacggtttactggacgagcgcctgcaggtcgcccattgtgtttacttcgatcgcaaggacgttcgcctgctgcatcgccacaacgtaaaggttgcttctcaggttgttagcaatgcgtatctgggttccggcgttgcgccggttccggaaatggtagaacgtggtatggccgttggtattggtaccgatgatggcaactgcaacgattccgtgaacatgattggcgatatgaagttcatggctcacattcatcgtgcagtacaccgcgacgcagacgttctgaccccggaaaagatcctggaaatggccaccatcgacggtgcgcgcagtctgggcatggaccatgaaattggcagcatcgaaaccggcaaacgtgctgacctgattctgctggatctgcgtcacccgcaaactaccccgcaccaccacctggcagctaccatcgtgtttcaggcatacggtaacgaagttgacaccgttttgatcgacggtaacgtcgtgatggaaaaccgccgtctgtcatttctgccgccggaacgtgaactggcttttctggaagaagctcagtcccgtgccactgcgatcctgcagcgtgcaaacatggttgcgaacccggcttggcgtagcctgtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z