BBa_M36789 1 BBa_M36789 [apFAB46][apFAB687BCD9][NarL][apFAB391][BBa_K216005] 2012-12-07T12:00:00Z 2015-05-08T01:14:06Z The NarL gene comes from the E. coli genome and was found on the UniProt database. The PyeaR promoter also comes from the E. coli genome and was found on the Parts Registry, designed by the 2009 Edinburgh iGEM team. The first component is a strong constitutive promoter (apFAB46 from BioFab database), followed by a bicistronic RBS (apFAB687BCD9 from BioFab database), linked up to production of the NarL gene downstream (P0AF28 from UniProt database). This constitutively promotes NarL, which is one of the regulatory proteins for the napF operon, which encodes for periplasmic nitrate reductase (see Darwin, A., Ziegelhoffer, E., Kiley, P., Stewart, V. 1998. Fnr, NarP, and NarL Regulation of Escherichia coli K-12 napF (Periplasmic Nitrate Reductase) Operon Transcription In Vitro. Journal of Bacteriology, p. 4192-4198). This constitutive production ensures that there will be extra NarL in the cell if the PyeaR promoter diverts all of the naturally produced NarL from other cell functions. A strong terminator with 99% termination efficiency follows (apFAB391 from BioFab database), which is crucial because the constitutive promoter could send a false signal to the PyeaR promoter downstream of the NarL expression region. The last component is the PyeaR promoter (BBa_K216005 from Parts Registry), designed by the 2009 Edinburgh iGEM team. This promoter is regulated by phosphorylated NarL and is responsive to nitrate, nitrite, and nitric oxide in E. coli. false false _848_ 0 15048 9 Not in stock false This was the ideal sequence, but synthesis issues led to two mutants. The first mutant had the following mutations: - 864 (substitution T --> C in the terminator) - 22 (deletion T in the constitutive promoter) - 23 (deletion C in the constitutive promoter) The second mutant had the following mutations: - 131 (deletion T in the RBS) - 136 (deletion T in the NarL gene) - 137 (deletion C in the NarL gene) false Marisa Borja & Allison Mateo annotation2213695 1 promoter -10 region range2213695 1 89 94 annotation2213692 1 NarL-binding region range2213692 1 50 65 annotation2213696 1 BBa_K216005 range2213696 1 1 100 annotation2213694 1 promoter -35 region range2213694 1 66 71 annotation2213693 1 NsrR-binding region range2213693 1 58 80 BBa_M36789_sequence 1 aaaaagagtattgacttcgcatctttttgtacctataatagattcatgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcagaggagtctttctaatgtctaaccaggaaccggcgaccatcctgctgatcgacgaccacccgatgctgcgtaccggtgttaaacagctgatctctatggcgccggacatcaccgttgttggtgaagcgtctaacggtgaacagggtatcgaactggcggaatctctggacccggacctgatcctgctggacctgaacatgccgggtatgaacggtctggaaaccctggacaaactgcgtgaaaaatctctgtctggtcgtatcgttgttttctctgtttctaaccacgaagaagacgttgttaccgcgctgaaacgtggtgcggacggttacctgctgaaagacatggaaccggaagacctgctgaaagcgctgcaccaggcggcggcgggtgaaatggttctgtctgaagcgctgaccccggttctggcggcgtctctgcgtgcgaaccgtgcgaccaccgaacgtgacgttaaccagctgaccccgcgtgaacgtgacatcctgaaactgatcgcgcagggtctgccgaacaaaatgatcgcgcgtcgtctggacatcaccgaatctaccgttaaagttcacgttaaacacatgctgaaaaaaatgaaactgaaatctcgtgttgaagcggcggtttgggttcaccaggaacgtatcttctagtcggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggaggggcagaaagatgaatgactgtcttcccatctataatcctccctgattcttcgctgatatggtgctaaaaagtaaccaataaatggtatttaaaatgcaaattatcaggcgtaccctgaaacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z