BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_M36800 1 BBa_M36800 Acetaldehyde Sensor 2014-04-29T11:00:00Z 2015-05-08T01:14:06Z The AlcR sequence was generated from Talaromyces stipitatus and codon-optimized for E. coli. This part senses intracellular acetaldehyde by co-inducing AlcR to promote transcription of a downstream actuator. false false _848_ 0 22144 9 In stock false A weaker promoter was used for the downstream actuator in case the AlcR had an activating effect on the AlcR operon. false Richard Li component2372775 1 BBa_J23119 annotation2372775 1 BBa_J23119 range2372775 1 1 35 BBa_M36800_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z